Incidental Mutation 'R5047:Vmn2r-ps130'
ID394431
Institutional Source Beutler Lab
Gene Symbol Vmn2r-ps130
Ensembl Gene ENSMUSG00000095658
Gene Namevomeronasal 2, receptor, pseudogene 130
Synonyms
MMRRC Submission 042637-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R5047 (G1)
Quality Score143
Status Validated
Chromosome17
Chromosomal Location23061367-23077425 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 23063820 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 158 (M158K)
Ref Sequence ENSEMBL: ENSMUSP00000135186 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000175853]
Predicted Effect probably benign
Transcript: ENSMUST00000175853
AA Change: M158K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000135186
Gene: ENSMUSG00000095658
AA Change: M158K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 76 469 5.4e-24 PFAM
Pfam:NCD3G 511 563 1.3e-21 PFAM
Pfam:7tm_3 594 831 2.1e-54 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.5%
Validation Efficiency 96% (49/51)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik G T 14: 49,770,438 A526D probably damaging Het
4930503E14Rik A T 14: 44,169,241 M117K possibly damaging Het
Adamts13 G A 2: 26,996,910 A1020T probably damaging Het
Atg3 C A 16: 45,178,232 D132E probably benign Het
Blzf1 A G 1: 164,306,468 M4T possibly damaging Het
Cdon G A 9: 35,478,639 R863Q probably damaging Het
Cyp2d40 C T 15: 82,760,259 R255H unknown Het
Evi5 T C 5: 107,821,874 K57R probably damaging Het
Fam186b T C 15: 99,280,686 E253G probably damaging Het
Fcgr1 A T 3: 96,285,884 F266I probably benign Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Gm10142 G T 10: 77,716,162 C119F probably damaging Het
Gpr63 A G 4: 25,008,202 S309G probably benign Het
Herc3 C T 6: 58,855,760 Q137* probably null Het
Jmy T A 13: 93,441,572 H696L possibly damaging Het
Kif13a T C 13: 46,788,085 H972R probably benign Het
Lama1 C T 17: 67,743,281 Q296* probably null Het
Lmf1 C T 17: 25,631,838 probably benign Het
Lpp T C 16: 24,971,846 C352R probably damaging Het
Ltbp1 T C 17: 75,292,886 probably benign Het
Maml3 G T 3: 51,690,841 D807E possibly damaging Het
Mdc1 T A 17: 35,847,844 V372D probably benign Het
Mst1 C A 9: 108,084,309 H579Q probably benign Het
Olfr1238 A G 2: 89,406,713 V122A probably damaging Het
Olfr26 G A 9: 38,855,289 V76I probably benign Het
Olfr398 T C 11: 73,984,378 T77A probably damaging Het
Olfr739 T C 14: 50,425,239 F240S probably damaging Het
Pcdhb22 G T 18: 37,519,126 G216C probably damaging Het
Phlpp2 A T 8: 109,913,619 H472L probably benign Het
Plscr3 A G 11: 69,850,091 probably null Het
Rab7 A T 6: 88,005,223 probably null Het
Rad50 A G 11: 53,674,696 probably null Het
Scgb1b20 A G 7: 33,373,312 probably null Het
Scn9a A C 2: 66,562,480 L256R probably damaging Het
Spag1 G T 15: 36,195,442 Q260H probably damaging Het
Tatdn3 T A 1: 191,046,278 I239F probably damaging Het
Tcof1 A G 18: 60,831,914 S578P possibly damaging Het
Top3b A G 16: 16,891,418 T657A probably benign Het
Tstd3 A G 4: 21,759,621 probably null Het
Ttc4 A T 4: 106,668,238 L233H probably damaging Het
Yeats2 A T 16: 20,208,465 Q822L probably damaging Het
Zfp976 A T 7: 42,613,419 C331* probably null Het
Other mutations in Vmn2r-ps130
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01929:Vmn2r-ps130 APN 17 23076877 missense possibly damaging 0.79
IGL02346:Vmn2r-ps130 APN 17 23061527 missense possibly damaging 0.89
IGL02373:Vmn2r-ps130 APN 17 23076892 nonsense probably null
R1511:Vmn2r-ps130 UTSW 17 23063801 missense probably benign 0.17
R2373:Vmn2r-ps130 UTSW 17 23061506 missense possibly damaging 0.93
R5317:Vmn2r-ps130 UTSW 17 23063583 missense probably benign
R5588:Vmn2r-ps130 UTSW 17 23063829 missense probably benign 0.44
R5785:Vmn2r-ps130 UTSW 17 23061487 missense probably benign
R6131:Vmn2r-ps130 UTSW 17 23063655 missense probably benign 0.00
R6273:Vmn2r-ps130 UTSW 17 23076785 missense probably benign 0.12
R6580:Vmn2r-ps130 UTSW 17 23063766 missense probably benign 0.00
R7660:Vmn2r-ps130 UTSW 17 23077032 missense probably damaging 1.00
R7852:Vmn2r-ps130 UTSW 17 23063814 missense probably benign 0.04
R7935:Vmn2r-ps130 UTSW 17 23063814 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GTCAACAGGAACTCTGATCTTTTG -3'
(R):5'- GCTCCATCAAGACTCTGAATAGTAC -3'

Sequencing Primer
(F):5'- GGAACTCTGATCTTTTGCCAAATATG -3'
(R):5'- CCCTTGAACTACATAGATTGGCTCAG -3'
Posted On2016-06-15