Incidental Mutation 'R5047:Mdc1'
ID394433
Institutional Source Beutler Lab
Gene Symbol Mdc1
Ensembl Gene ENSMUSG00000061607
Gene Namemediator of DNA damage checkpoint 1
SynonymsNFBD1
MMRRC Submission 042637-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.945) question?
Stock #R5047 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location35841515-35859670 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 35847844 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 372 (V372D)
Ref Sequence ENSEMBL: ENSMUSP00000080949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082337] [ENSMUST00000174124]
Predicted Effect probably benign
Transcript: ENSMUST00000082337
AA Change: V372D

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000080949
Gene: ENSMUSG00000061607
AA Change: V372D

DomainStartEndE-ValueType
low complexity region 12 18 N/A INTRINSIC
FHA 53 105 5.63e-9 SMART
low complexity region 194 215 N/A INTRINSIC
low complexity region 854 870 N/A INTRINSIC
low complexity region 969 987 N/A INTRINSIC
low complexity region 1008 1022 N/A INTRINSIC
internal_repeat_1 1027 1115 6.7e-11 PROSPERO
internal_repeat_2 1030 1141 2.36e-9 PROSPERO
internal_repeat_1 1266 1354 6.7e-11 PROSPERO
internal_repeat_2 1298 1417 2.36e-9 PROSPERO
low complexity region 1422 1445 N/A INTRINSIC
low complexity region 1457 1477 N/A INTRINSIC
BRCT 1502 1579 1.66e-1 SMART
BRCT 1612 1691 2.45e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174124
SMART Domains Protein: ENSMUSP00000133568
Gene: ENSMUSG00000061607

DomainStartEndE-ValueType
low complexity region 12 18 N/A INTRINSIC
FHA 53 105 5.63e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000225192
Meta Mutation Damage Score 0.1179 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.5%
Validation Efficiency 96% (49/51)
MGI Phenotype FUNCTION: The protein encoded by this gene contains an N-terminal forkhead domain, two BRCA1 C-terminal (BRCT) motifs and a central domain with 7 divergent copies of an approximately 41-amino acid sequence. The encoded protein is required to activate the intra-S phase and G2/M phase cell cycle checkpoints in response to DNA damage. This nuclear protein interacts with phosphorylated histone H2AX near sites of DNA double-strand breaks through its BRCT motifs, and facilitates recruitment of the ATM kinase and meiotic recombination 11 protein complex to DNA damage foci. Mice with mutations in this gene exhibit growth retardation, male infertility, immune defects, chromosome instability, DNA repair defects, and radiation sensitivity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice are smaller and display increased susceptibility to ionizing radiation, male infertility, T and B cell abnormalities, and increased genomic instability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik G T 14: 49,770,438 A526D probably damaging Het
4930503E14Rik A T 14: 44,169,241 M117K possibly damaging Het
Adamts13 G A 2: 26,996,910 A1020T probably damaging Het
Atg3 C A 16: 45,178,232 D132E probably benign Het
Blzf1 A G 1: 164,306,468 M4T possibly damaging Het
Cdon G A 9: 35,478,639 R863Q probably damaging Het
Cyp2d40 C T 15: 82,760,259 R255H unknown Het
Evi5 T C 5: 107,821,874 K57R probably damaging Het
Fam186b T C 15: 99,280,686 E253G probably damaging Het
Fcgr1 A T 3: 96,285,884 F266I probably benign Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Gm10142 G T 10: 77,716,162 C119F probably damaging Het
Gpr63 A G 4: 25,008,202 S309G probably benign Het
Herc3 C T 6: 58,855,760 Q137* probably null Het
Jmy T A 13: 93,441,572 H696L possibly damaging Het
Kif13a T C 13: 46,788,085 H972R probably benign Het
Lama1 C T 17: 67,743,281 Q296* probably null Het
Lmf1 C T 17: 25,631,838 probably benign Het
Lpp T C 16: 24,971,846 C352R probably damaging Het
Ltbp1 T C 17: 75,292,886 probably benign Het
Maml3 G T 3: 51,690,841 D807E possibly damaging Het
Mst1 C A 9: 108,084,309 H579Q probably benign Het
Olfr1238 A G 2: 89,406,713 V122A probably damaging Het
Olfr26 G A 9: 38,855,289 V76I probably benign Het
Olfr398 T C 11: 73,984,378 T77A probably damaging Het
Olfr739 T C 14: 50,425,239 F240S probably damaging Het
Pcdhb22 G T 18: 37,519,126 G216C probably damaging Het
Phlpp2 A T 8: 109,913,619 H472L probably benign Het
Plscr3 A G 11: 69,850,091 probably null Het
Rab7 A T 6: 88,005,223 probably null Het
Rad50 A G 11: 53,674,696 probably null Het
Scgb1b20 A G 7: 33,373,312 probably null Het
Scn9a A C 2: 66,562,480 L256R probably damaging Het
Spag1 G T 15: 36,195,442 Q260H probably damaging Het
Tatdn3 T A 1: 191,046,278 I239F probably damaging Het
Tcof1 A G 18: 60,831,914 S578P possibly damaging Het
Top3b A G 16: 16,891,418 T657A probably benign Het
Tstd3 A G 4: 21,759,621 probably null Het
Ttc4 A T 4: 106,668,238 L233H probably damaging Het
Vmn2r-ps130 T A 17: 23,063,820 M158K probably benign Het
Yeats2 A T 16: 20,208,465 Q822L probably damaging Het
Zfp976 A T 7: 42,613,419 C331* probably null Het
Other mutations in Mdc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01473:Mdc1 APN 17 35848020 missense probably benign 0.04
IGL01662:Mdc1 APN 17 35852505 missense probably benign 0.00
IGL01931:Mdc1 APN 17 35848231 missense probably benign 0.00
IGL02542:Mdc1 APN 17 35853156 missense probably damaging 0.96
IGL02823:Mdc1 APN 17 35852923 missense probably damaging 0.99
IGL03411:Mdc1 APN 17 35853126 missense probably benign 0.06
IGL02799:Mdc1 UTSW 17 35846191 missense possibly damaging 0.86
PIT4362001:Mdc1 UTSW 17 35844469 missense possibly damaging 0.72
R0054:Mdc1 UTSW 17 35849033 missense probably benign 0.00
R0129:Mdc1 UTSW 17 35854445 missense probably benign 0.04
R0131:Mdc1 UTSW 17 35852581 missense probably damaging 0.99
R0131:Mdc1 UTSW 17 35852581 missense probably damaging 0.99
R0132:Mdc1 UTSW 17 35852581 missense probably damaging 0.99
R1406:Mdc1 UTSW 17 35853532 missense probably benign 0.10
R1406:Mdc1 UTSW 17 35853532 missense probably benign 0.10
R1597:Mdc1 UTSW 17 35845866 missense probably damaging 1.00
R1721:Mdc1 UTSW 17 35847826 missense possibly damaging 0.85
R1888:Mdc1 UTSW 17 35854225 missense probably benign 0.03
R1888:Mdc1 UTSW 17 35854225 missense probably benign 0.03
R1912:Mdc1 UTSW 17 35844538 missense probably benign 0.00
R1912:Mdc1 UTSW 17 35850811 missense probably benign 0.19
R1977:Mdc1 UTSW 17 35850930 missense probably benign 0.01
R2121:Mdc1 UTSW 17 35847943 missense probably benign 0.03
R2122:Mdc1 UTSW 17 35847943 missense probably benign 0.03
R2357:Mdc1 UTSW 17 35847445 missense probably benign 0.00
R2842:Mdc1 UTSW 17 35848794 missense probably benign 0.01
R2851:Mdc1 UTSW 17 35849010 missense probably benign 0.04
R2852:Mdc1 UTSW 17 35849010 missense probably benign 0.04
R2964:Mdc1 UTSW 17 35853637 missense possibly damaging 0.72
R2996:Mdc1 UTSW 17 35847893 unclassified probably benign
R3752:Mdc1 UTSW 17 35845929 missense probably damaging 1.00
R4234:Mdc1 UTSW 17 35848824 missense probably benign 0.00
R4641:Mdc1 UTSW 17 35857469 missense probably benign 0.09
R4706:Mdc1 UTSW 17 35852779 missense probably damaging 0.99
R4809:Mdc1 UTSW 17 35849101 critical splice donor site probably null
R4833:Mdc1 UTSW 17 35850394 missense probably benign 0.20
R5032:Mdc1 UTSW 17 35850589 missense probably benign 0.00
R5086:Mdc1 UTSW 17 35848630 missense probably benign 0.00
R5172:Mdc1 UTSW 17 35853090 missense probably benign 0.00
R5254:Mdc1 UTSW 17 35847922 missense probably benign 0.00
R5473:Mdc1 UTSW 17 35848060 missense probably benign 0.01
R5550:Mdc1 UTSW 17 35845884 missense possibly damaging 0.64
R5561:Mdc1 UTSW 17 35848546 missense probably benign 0.00
R5888:Mdc1 UTSW 17 35847820 missense probably benign 0.01
R6020:Mdc1 UTSW 17 35848633 missense probably benign 0.04
R6020:Mdc1 UTSW 17 35857572 missense probably benign 0.01
R6219:Mdc1 UTSW 17 35850674 missense probably benign 0.10
R7053:Mdc1 UTSW 17 35846326 missense probably benign 0.00
R7073:Mdc1 UTSW 17 35854068 missense probably benign 0.18
R7077:Mdc1 UTSW 17 35845947 missense probably damaging 0.97
R7424:Mdc1 UTSW 17 35853309 missense probably benign 0.04
R7443:Mdc1 UTSW 17 35850820 missense probably damaging 0.98
R7467:Mdc1 UTSW 17 35844556 missense probably benign 0.29
R7549:Mdc1 UTSW 17 35848857 missense probably null 0.04
R7655:Mdc1 UTSW 17 35850881 missense probably benign 0.01
R7656:Mdc1 UTSW 17 35850881 missense probably benign 0.01
RF025:Mdc1 UTSW 17 35854407 critical splice acceptor site probably benign
X0022:Mdc1 UTSW 17 35850937 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTGGACGAAGATCACAAACCTG -3'
(R):5'- GGCTTTGTTCTACAAGGACCTG -3'

Sequencing Primer
(F):5'- AAACCTGGGTTTGCGGAC -3'
(R):5'- CTACAAGGACCTGTGGTTGGGAC -3'
Posted On2016-06-15