Incidental Mutation 'R5047:Ltbp1'
ID394435
Institutional Source Beutler Lab
Gene Symbol Ltbp1
Ensembl Gene ENSMUSG00000001870
Gene Namelatent transforming growth factor beta binding protein 1
Synonymsb2b1000Clo, LTBP-1, 9430031G15Rik
MMRRC Submission 042637-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5047 (G1)
Quality Score185
Status Validated
Chromosome17
Chromosomal Location75005568-75392512 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 75292886 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116890 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001927] [ENSMUST00000112514] [ENSMUST00000112516] [ENSMUST00000135447]
Predicted Effect probably benign
Transcript: ENSMUST00000001927
SMART Domains Protein: ENSMUSP00000001927
Gene: ENSMUSG00000001870

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 34 49 N/A INTRINSIC
low complexity region 58 73 N/A INTRINSIC
low complexity region 94 109 N/A INTRINSIC
low complexity region 149 158 N/A INTRINSIC
EGF 184 213 9.27e-1 SMART
EGF 394 423 2.23e-3 SMART
Pfam:TB 559 601 2.4e-9 PFAM
EGF_CA 618 658 9.39e-11 SMART
Pfam:TB 680 720 1e-18 PFAM
low complexity region 839 849 N/A INTRINSIC
EGF_CA 865 906 5.83e-7 SMART
EGF_CA 907 948 6.39e-13 SMART
EGF_CA 949 989 4.25e-9 SMART
EGF_CA 990 1029 2.44e-9 SMART
EGF_CA 1030 1070 5.87e-12 SMART
EGF_CA 1071 1111 3.61e-12 SMART
EGF_CA 1112 1152 1.57e-12 SMART
EGF_CA 1153 1193 1.75e-10 SMART
EGF_CA 1194 1235 6.74e-12 SMART
EGF_CA 1236 1277 3.22e-9 SMART
EGF 1281 1320 2.16e1 SMART
Pfam:TB 1349 1391 5.6e-17 PFAM
EGF 1418 1457 1.14e0 SMART
EGF_CA 1458 1498 2.68e-6 SMART
Pfam:TB 1526 1567 4.2e-15 PFAM
EGF 1615 1652 1e-5 SMART
EGF_CA 1653 1697 5.11e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112514
SMART Domains Protein: ENSMUSP00000108133
Gene: ENSMUSG00000001870

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
EGF 76 105 2.23e-3 SMART
Pfam:TB 240 283 9.5e-13 PFAM
EGF_CA 300 340 9.39e-11 SMART
Pfam:TB 361 400 3.1e-17 PFAM
low complexity region 468 478 N/A INTRINSIC
EGF_CA 494 535 5.83e-7 SMART
EGF_CA 536 577 6.39e-13 SMART
EGF_CA 578 618 4.25e-9 SMART
EGF_CA 619 658 2.44e-9 SMART
EGF_CA 659 699 5.87e-12 SMART
EGF_CA 700 740 3.61e-12 SMART
EGF_CA 741 781 1.57e-12 SMART
EGF_CA 782 822 1.75e-10 SMART
EGF_CA 823 864 6.74e-12 SMART
EGF_CA 865 906 3.22e-9 SMART
EGF 910 949 2.16e1 SMART
Pfam:TB 977 1020 4.3e-20 PFAM
EGF 1047 1086 1.14e0 SMART
EGF_CA 1087 1127 2.68e-6 SMART
Pfam:TB 1154 1196 1.3e-17 PFAM
EGF 1244 1281 1e-5 SMART
EGF_CA 1282 1326 5.11e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112516
SMART Domains Protein: ENSMUSP00000108135
Gene: ENSMUSG00000001870

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
EGF 76 105 2.23e-3 SMART
Pfam:TB 240 283 9.9e-13 PFAM
EGF_CA 300 340 9.39e-11 SMART
Pfam:TB 361 402 7.6e-20 PFAM
low complexity region 521 531 N/A INTRINSIC
EGF_CA 547 588 5.83e-7 SMART
EGF_CA 589 630 6.39e-13 SMART
EGF_CA 631 671 4.25e-9 SMART
EGF_CA 672 711 2.44e-9 SMART
EGF_CA 712 752 5.87e-12 SMART
EGF_CA 753 793 3.61e-12 SMART
EGF_CA 794 834 1.57e-12 SMART
EGF_CA 835 875 1.75e-10 SMART
EGF_CA 876 917 6.74e-12 SMART
EGF_CA 918 959 3.22e-9 SMART
EGF 963 1002 2.16e1 SMART
Pfam:TB 1030 1073 4.5e-20 PFAM
EGF 1100 1139 1.14e0 SMART
EGF_CA 1140 1180 2.68e-6 SMART
Pfam:TB 1207 1249 1.4e-17 PFAM
EGF 1297 1334 1e-5 SMART
EGF_CA 1335 1379 5.11e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127458
Predicted Effect probably benign
Transcript: ENSMUST00000135447
SMART Domains Protein: ENSMUSP00000116890
Gene: ENSMUSG00000001870

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
EGF 76 105 1.1e-5 SMART
Pfam:TB 240 283 4.3e-10 PFAM
EGF_CA 300 340 4.4e-13 SMART
Pfam:TB 361 402 3.3e-17 PFAM
low complexity region 521 531 N/A INTRINSIC
EGF_CA 547 588 2.9e-9 SMART
EGF_CA 589 630 3e-15 SMART
EGF_CA 631 671 2.1e-11 SMART
EGF_CA 672 711 1.2e-11 SMART
EGF_CA 712 752 2.8e-14 SMART
EGF_CA 753 793 1.8e-14 SMART
EGF_CA 794 834 7.5e-15 SMART
EGF_CA 835 875 8.4e-13 SMART
EGF_CA 876 917 3.2e-14 SMART
EGF_CA 918 959 1.6e-11 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.5%
Validation Efficiency 96% (49/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of latent TGF-beta binding proteins (LTBPs). The secretion and activation of TGF-betas is regulated by their association with latency-associated proteins and with latent TGF-beta binding proteins. The product of this gene targets latent complexes of transforming growth factor beta to the extracellular matrix, where the latent cytokine is subsequently activated by several different mechanisms. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic and neonatal lethality associated with defects in the aortic arch and outflow tract. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik G T 14: 49,770,438 A526D probably damaging Het
4930503E14Rik A T 14: 44,169,241 M117K possibly damaging Het
Adamts13 G A 2: 26,996,910 A1020T probably damaging Het
Atg3 C A 16: 45,178,232 D132E probably benign Het
Blzf1 A G 1: 164,306,468 M4T possibly damaging Het
Cdon G A 9: 35,478,639 R863Q probably damaging Het
Cyp2d40 C T 15: 82,760,259 R255H unknown Het
Evi5 T C 5: 107,821,874 K57R probably damaging Het
Fam186b T C 15: 99,280,686 E253G probably damaging Het
Fcgr1 A T 3: 96,285,884 F266I probably benign Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Gm10142 G T 10: 77,716,162 C119F probably damaging Het
Gpr63 A G 4: 25,008,202 S309G probably benign Het
Herc3 C T 6: 58,855,760 Q137* probably null Het
Jmy T A 13: 93,441,572 H696L possibly damaging Het
Kif13a T C 13: 46,788,085 H972R probably benign Het
Lama1 C T 17: 67,743,281 Q296* probably null Het
Lmf1 C T 17: 25,631,838 probably benign Het
Lpp T C 16: 24,971,846 C352R probably damaging Het
Maml3 G T 3: 51,690,841 D807E possibly damaging Het
Mdc1 T A 17: 35,847,844 V372D probably benign Het
Mst1 C A 9: 108,084,309 H579Q probably benign Het
Olfr1238 A G 2: 89,406,713 V122A probably damaging Het
Olfr26 G A 9: 38,855,289 V76I probably benign Het
Olfr398 T C 11: 73,984,378 T77A probably damaging Het
Olfr739 T C 14: 50,425,239 F240S probably damaging Het
Pcdhb22 G T 18: 37,519,126 G216C probably damaging Het
Phlpp2 A T 8: 109,913,619 H472L probably benign Het
Plscr3 A G 11: 69,850,091 probably null Het
Rab7 A T 6: 88,005,223 probably null Het
Rad50 A G 11: 53,674,696 probably null Het
Scgb1b20 A G 7: 33,373,312 probably null Het
Scn9a A C 2: 66,562,480 L256R probably damaging Het
Spag1 G T 15: 36,195,442 Q260H probably damaging Het
Tatdn3 T A 1: 191,046,278 I239F probably damaging Het
Tcof1 A G 18: 60,831,914 S578P possibly damaging Het
Top3b A G 16: 16,891,418 T657A probably benign Het
Tstd3 A G 4: 21,759,621 probably null Het
Ttc4 A T 4: 106,668,238 L233H probably damaging Het
Vmn2r-ps130 T A 17: 23,063,820 M158K probably benign Het
Yeats2 A T 16: 20,208,465 Q822L probably damaging Het
Zfp976 A T 7: 42,613,419 C331* probably null Het
Other mutations in Ltbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Ltbp1 APN 17 75225338 missense probably damaging 1.00
IGL00156:Ltbp1 APN 17 75385160 missense probably damaging 0.97
IGL00161:Ltbp1 APN 17 75310152 splice site probably benign
IGL00771:Ltbp1 APN 17 75362516 missense probably damaging 1.00
IGL00822:Ltbp1 APN 17 75151321 missense probably damaging 1.00
IGL01760:Ltbp1 APN 17 75227150 missense probably damaging 0.97
IGL01796:Ltbp1 APN 17 75227245 splice site probably benign
IGL01826:Ltbp1 APN 17 75292840 missense possibly damaging 0.67
IGL02372:Ltbp1 APN 17 75252406 missense probably damaging 0.99
IGL02792:Ltbp1 APN 17 75282994 missense probably damaging 1.00
IGL02862:Ltbp1 APN 17 75390471 missense probably damaging 1.00
IGL03095:Ltbp1 APN 17 75282418 missense possibly damaging 0.67
IGL03345:Ltbp1 APN 17 75066159 missense probably damaging 0.99
IGL03404:Ltbp1 APN 17 75225306 missense probably damaging 0.97
R0010:Ltbp1 UTSW 17 75363391 missense probably damaging 1.00
R0010:Ltbp1 UTSW 17 75363391 missense probably damaging 1.00
R0022:Ltbp1 UTSW 17 75364360 missense probably damaging 1.00
R0022:Ltbp1 UTSW 17 75364360 missense probably damaging 1.00
R0033:Ltbp1 UTSW 17 75276509 missense possibly damaging 0.66
R0033:Ltbp1 UTSW 17 75276509 missense possibly damaging 0.66
R0034:Ltbp1 UTSW 17 75047568 intron probably benign
R0068:Ltbp1 UTSW 17 75359409 missense probably damaging 1.00
R0068:Ltbp1 UTSW 17 75359409 missense probably damaging 1.00
R0467:Ltbp1 UTSW 17 75282429 critical splice donor site probably null
R0554:Ltbp1 UTSW 17 75225279 missense probably damaging 0.99
R0584:Ltbp1 UTSW 17 75363472 missense probably damaging 1.00
R0863:Ltbp1 UTSW 17 75252386 missense probably damaging 1.00
R0991:Ltbp1 UTSW 17 75225285 missense possibly damaging 0.75
R1084:Ltbp1 UTSW 17 75359425 nonsense probably null
R1114:Ltbp1 UTSW 17 75360775 missense probably benign
R1177:Ltbp1 UTSW 17 75225285 missense possibly damaging 0.75
R1179:Ltbp1 UTSW 17 75225285 missense possibly damaging 0.75
R1195:Ltbp1 UTSW 17 75225285 missense possibly damaging 0.75
R1195:Ltbp1 UTSW 17 75225285 missense possibly damaging 0.75
R1195:Ltbp1 UTSW 17 75225285 missense possibly damaging 0.75
R1245:Ltbp1 UTSW 17 75327194 splice site probably benign
R1246:Ltbp1 UTSW 17 75385161 nonsense probably null
R1258:Ltbp1 UTSW 17 75225285 missense possibly damaging 0.75
R1259:Ltbp1 UTSW 17 75225285 missense possibly damaging 0.75
R1260:Ltbp1 UTSW 17 75225285 missense possibly damaging 0.75
R1262:Ltbp1 UTSW 17 75225285 missense possibly damaging 0.75
R1265:Ltbp1 UTSW 17 75225285 missense possibly damaging 0.75
R1267:Ltbp1 UTSW 17 75225285 missense possibly damaging 0.75
R1269:Ltbp1 UTSW 17 75225285 missense possibly damaging 0.75
R1272:Ltbp1 UTSW 17 75225285 missense possibly damaging 0.75
R1411:Ltbp1 UTSW 17 75225285 missense possibly damaging 0.75
R1579:Ltbp1 UTSW 17 75252367 missense probably benign 0.00
R1694:Ltbp1 UTSW 17 75225285 missense possibly damaging 0.75
R1705:Ltbp1 UTSW 17 75385201 splice site probably null
R1716:Ltbp1 UTSW 17 75315024 missense probably benign 0.08
R1815:Ltbp1 UTSW 17 75252380 missense probably benign 0.00
R1932:Ltbp1 UTSW 17 75313034 missense probably benign 0.01
R1951:Ltbp1 UTSW 17 75151377 missense probably benign 0.00
R2044:Ltbp1 UTSW 17 75276432 missense probably damaging 1.00
R2118:Ltbp1 UTSW 17 75310159 missense possibly damaging 0.52
R2120:Ltbp1 UTSW 17 75310159 missense possibly damaging 0.52
R2121:Ltbp1 UTSW 17 75310159 missense possibly damaging 0.52
R2122:Ltbp1 UTSW 17 75310159 missense possibly damaging 0.52
R2171:Ltbp1 UTSW 17 75291317 missense probably damaging 0.99
R2237:Ltbp1 UTSW 17 75310163 missense probably benign 0.31
R2655:Ltbp1 UTSW 17 75005983 missense possibly damaging 0.76
R2941:Ltbp1 UTSW 17 75179093 missense probably damaging 1.00
R3177:Ltbp1 UTSW 17 75276480 missense possibly damaging 0.65
R3177:Ltbp1 UTSW 17 75359278 splice site probably null
R3277:Ltbp1 UTSW 17 75276480 missense possibly damaging 0.65
R3277:Ltbp1 UTSW 17 75359278 splice site probably null
R3797:Ltbp1 UTSW 17 75362630 missense probably damaging 1.00
R3861:Ltbp1 UTSW 17 75359338 missense possibly damaging 0.93
R3897:Ltbp1 UTSW 17 75274016 missense probably damaging 1.00
R4002:Ltbp1 UTSW 17 75310159 missense probably benign 0.09
R4057:Ltbp1 UTSW 17 75310194 missense probably damaging 1.00
R4261:Ltbp1 UTSW 17 75291367 nonsense probably null
R4375:Ltbp1 UTSW 17 75312997 missense probably damaging 1.00
R4458:Ltbp1 UTSW 17 75276507 missense possibly damaging 0.96
R4519:Ltbp1 UTSW 17 75364497 missense probably benign 0.14
R4529:Ltbp1 UTSW 17 75151360 missense probably benign 0.21
R4614:Ltbp1 UTSW 17 75289994 intron probably benign
R4724:Ltbp1 UTSW 17 75313008 missense probably damaging 0.99
R4756:Ltbp1 UTSW 17 75225204 missense probably damaging 1.00
R4907:Ltbp1 UTSW 17 75005904 missense probably benign
R4910:Ltbp1 UTSW 17 75327292 missense probably damaging 1.00
R4976:Ltbp1 UTSW 17 75321095 critical splice donor site probably null
R5011:Ltbp1 UTSW 17 75066157 missense probably damaging 0.99
R5259:Ltbp1 UTSW 17 75363362 missense probably benign 0.03
R5438:Ltbp1 UTSW 17 75291326 missense probably damaging 0.98
R5583:Ltbp1 UTSW 17 75291330 missense probably benign 0.00
R5757:Ltbp1 UTSW 17 75273949 splice site probably null
R5950:Ltbp1 UTSW 17 75273870 missense probably damaging 1.00
R5976:Ltbp1 UTSW 17 75290083 missense probably damaging 1.00
R6267:Ltbp1 UTSW 17 75005989 missense possibly damaging 0.70
R6383:Ltbp1 UTSW 17 75359457 missense probably damaging 0.99
R6400:Ltbp1 UTSW 17 75151402 missense possibly damaging 0.62
R6861:Ltbp1 UTSW 17 75227192 missense possibly damaging 0.76
R6880:Ltbp1 UTSW 17 75321049 missense possibly damaging 0.77
R7168:Ltbp1 UTSW 17 75291366 missense probably damaging 1.00
R7198:Ltbp1 UTSW 17 75226967 missense possibly damaging 0.94
R7260:Ltbp1 UTSW 17 75066144 missense probably benign 0.01
R7262:Ltbp1 UTSW 17 75364368 missense probably damaging 1.00
R7340:Ltbp1 UTSW 17 75327228 nonsense probably null
R7443:Ltbp1 UTSW 17 75364437 missense probably damaging 1.00
R7510:Ltbp1 UTSW 17 75352717 missense probably damaging 1.00
R7676:Ltbp1 UTSW 17 75291297 missense possibly damaging 0.58
R7717:Ltbp1 UTSW 17 75290078 missense possibly damaging 0.90
R7720:Ltbp1 UTSW 17 75385124 missense probably damaging 1.00
R7799:Ltbp1 UTSW 17 75252356 missense probably damaging 0.99
R7944:Ltbp1 UTSW 17 75390551 makesense probably null
R7945:Ltbp1 UTSW 17 75390551 makesense probably null
R7976:Ltbp1 UTSW 17 75363363 missense possibly damaging 0.94
R8256:Ltbp1 UTSW 17 75315241 intron probably benign
R8295:Ltbp1 UTSW 17 75179189 missense probably benign 0.10
R8423:Ltbp1 UTSW 17 75292857 missense probably benign
X0001:Ltbp1 UTSW 17 75227178 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- TGACTCATCCCGGACCATAC -3'
(R):5'- TAACTGTGCTCGCAACTGC -3'

Sequencing Primer
(F):5'- CGGACCATACTTTATGTTTCATGCAG -3'
(R):5'- GTGCTCGCAACTGCAAACACTAG -3'
Posted On2016-06-15