Incidental Mutation 'R5048:Slc6a17'
ID 394451
Institutional Source Beutler Lab
Gene Symbol Slc6a17
Ensembl Gene ENSMUSG00000027894
Gene Name solute carrier family 6 (neurotransmitter transporter), member 17
Synonyms NTT4, D130012J15Rik
MMRRC Submission 042638-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.256) question?
Stock # R5048 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 107374864-107425334 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 107378753 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Stop codon at position 643 (L643*)
Ref Sequence ENSEMBL: ENSMUSP00000129379 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029499] [ENSMUST00000168211] [ENSMUST00000169449]
AlphaFold Q8BJI1
Predicted Effect probably null
Transcript: ENSMUST00000029499
AA Change: L640*
SMART Domains Protein: ENSMUSP00000029499
Gene: ENSMUSG00000027894
AA Change: L640*

DomainStartEndE-ValueType
Pfam:SNF 60 640 2.7e-227 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000168211
AA Change: L602*
SMART Domains Protein: ENSMUSP00000131888
Gene: ENSMUSG00000027894
AA Change: L602*

DomainStartEndE-ValueType
Pfam:SNF 19 602 1.3e-225 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000169449
AA Change: L643*
SMART Domains Protein: ENSMUSP00000129379
Gene: ENSMUSG00000027894
AA Change: L643*

DomainStartEndE-ValueType
Pfam:SNF 60 643 1.1e-225 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171029
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.1%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SLC6 family of transporters, which are responsible for the presynaptic uptake of most neurotransmitters. The encoded vesicular transporter is selective for proline, glycine, leucine and alanine. Defects in this gene are a cause of autosomal recessive mental retardation-48. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 T C 2: 69,138,850 (GRCm39) I144V probably benign Het
Abhd5 T C 9: 122,206,968 (GRCm39) Y85H probably damaging Het
Acadsb G A 7: 131,039,198 (GRCm39) G323D probably damaging Het
Amotl2 A G 9: 102,600,997 (GRCm39) R322G probably benign Het
Aox1 A T 1: 58,098,641 (GRCm39) probably benign Het
Aste1 C T 9: 105,274,188 (GRCm39) R82W probably damaging Het
Atg4b T C 1: 93,703,380 (GRCm39) I139T possibly damaging Het
Btnl5-ps T A 17: 34,707,697 (GRCm39) noncoding transcript Het
Ccdc85c A G 12: 108,187,966 (GRCm39) probably null Het
Clasp1 A G 1: 118,475,340 (GRCm39) probably benign Het
Defb10 G A 8: 22,351,887 (GRCm39) C44Y probably damaging Het
Dhrs9 T C 2: 69,224,744 (GRCm39) V144A probably damaging Het
Dnhd1 G C 7: 105,342,904 (GRCm39) S1416T probably benign Het
Dok1 T A 6: 83,009,087 (GRCm39) probably benign Het
Emilin2 G A 17: 71,580,962 (GRCm39) T588M probably damaging Het
Fam181b A G 7: 92,729,147 (GRCm39) probably benign Het
Fhad1 T C 4: 141,691,987 (GRCm39) probably null Het
Foxi2 A G 7: 135,013,364 (GRCm39) E198G probably damaging Het
Fsip2 C A 2: 82,823,494 (GRCm39) A6409E probably damaging Het
Gje1 T C 10: 14,593,021 (GRCm39) Y65C probably damaging Het
Gm6401 T C 14: 41,789,724 (GRCm39) probably null Het
Gprc5c T C 11: 114,761,177 (GRCm39) *442Q probably null Het
Iars1 T A 13: 49,841,713 (GRCm39) I67N probably damaging Het
Igkv4-79 T C 6: 69,019,971 (GRCm39) S115G probably benign Het
Itga4 C A 2: 79,103,378 (GRCm39) S156R probably benign Het
Lilra6 C T 7: 3,918,440 (GRCm39) probably null Het
Majin C A 19: 6,272,684 (GRCm39) A208E probably benign Het
Megf8 A G 7: 25,030,517 (GRCm39) Q490R possibly damaging Het
Mfng C T 15: 78,648,588 (GRCm39) R163H probably benign Het
Mgarp G A 3: 51,298,707 (GRCm39) R88C probably damaging Het
Msh2 T C 17: 87,980,196 (GRCm39) F58S probably damaging Het
Nemp1 T C 10: 127,526,804 (GRCm39) probably null Het
Nlrp10 A T 7: 108,523,772 (GRCm39) N569K probably benign Het
Nxpe2 T C 9: 48,237,388 (GRCm39) probably null Het
Or4c106 T C 2: 88,682,807 (GRCm39) V171A possibly damaging Het
Or5w16 C A 2: 87,576,663 (GRCm39) A41E probably benign Het
Pdcd11 C A 19: 47,095,554 (GRCm39) S625R probably benign Het
Pigb T A 9: 72,936,990 (GRCm39) probably null Het
Pitpnb T C 5: 111,530,869 (GRCm39) F221L possibly damaging Het
Prox2 A T 12: 85,141,115 (GRCm39) W363R probably damaging Het
Psmg1 T A 16: 95,785,171 (GRCm39) R139S probably benign Het
Rab11fip3 A G 17: 26,286,554 (GRCm39) probably null Het
Samd9l G A 6: 3,374,157 (GRCm39) R1035C probably benign Het
Shkbp1 G A 7: 27,051,521 (GRCm39) probably benign Het
Slc30a5 C A 13: 100,943,249 (GRCm39) L536F probably damaging Het
Slit3 T C 11: 35,479,812 (GRCm39) Y330H probably damaging Het
St13 G C 15: 81,283,786 (GRCm39) R4G probably benign Het
Stoml3 A C 3: 53,408,213 (GRCm39) K86N possibly damaging Het
Tmtc1 A T 6: 148,139,344 (GRCm39) L926Q possibly damaging Het
Tns4 T G 11: 98,969,605 (GRCm39) R285S possibly damaging Het
Uncx C T 5: 139,532,874 (GRCm39) T313M probably benign Het
Vmn2r75 G A 7: 85,814,735 (GRCm39) R253C possibly damaging Het
Zbed6 T C 1: 133,586,462 (GRCm39) S292G probably damaging Het
Zfp143 A G 7: 109,673,325 (GRCm39) T142A probably damaging Het
Zfp287 T C 11: 62,605,777 (GRCm39) K366E probably damaging Het
Other mutations in Slc6a17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02432:Slc6a17 APN 3 107,400,493 (GRCm39) missense possibly damaging 0.56
IGL02514:Slc6a17 APN 3 107,402,993 (GRCm39) missense possibly damaging 0.94
IGL03395:Slc6a17 APN 3 107,384,622 (GRCm39) missense probably damaging 1.00
BB002:Slc6a17 UTSW 3 107,403,056 (GRCm39) missense probably damaging 1.00
BB012:Slc6a17 UTSW 3 107,403,056 (GRCm39) missense probably damaging 1.00
R0454:Slc6a17 UTSW 3 107,384,183 (GRCm39) missense probably benign 0.12
R1201:Slc6a17 UTSW 3 107,400,388 (GRCm39) missense possibly damaging 0.90
R1551:Slc6a17 UTSW 3 107,379,443 (GRCm39) missense possibly damaging 0.85
R1681:Slc6a17 UTSW 3 107,381,702 (GRCm39) missense probably damaging 1.00
R1721:Slc6a17 UTSW 3 107,379,492 (GRCm39) missense probably damaging 1.00
R1765:Slc6a17 UTSW 3 107,380,895 (GRCm39) missense possibly damaging 0.95
R1867:Slc6a17 UTSW 3 107,379,492 (GRCm39) missense probably damaging 1.00
R2167:Slc6a17 UTSW 3 107,398,817 (GRCm39) nonsense probably null
R3708:Slc6a17 UTSW 3 107,400,401 (GRCm39) missense probably benign
R3814:Slc6a17 UTSW 3 107,378,633 (GRCm39) missense possibly damaging 0.92
R4639:Slc6a17 UTSW 3 107,381,597 (GRCm39) missense probably benign
R4807:Slc6a17 UTSW 3 107,407,803 (GRCm39) missense possibly damaging 0.90
R6076:Slc6a17 UTSW 3 107,379,387 (GRCm39) missense possibly damaging 0.67
R6326:Slc6a17 UTSW 3 107,407,722 (GRCm39) missense probably damaging 0.98
R6713:Slc6a17 UTSW 3 107,378,703 (GRCm39) missense probably benign 0.00
R7073:Slc6a17 UTSW 3 107,378,755 (GRCm39) missense probably benign 0.00
R7097:Slc6a17 UTSW 3 107,400,464 (GRCm39) missense probably damaging 1.00
R7323:Slc6a17 UTSW 3 107,398,794 (GRCm39) missense probably benign 0.01
R7597:Slc6a17 UTSW 3 107,378,668 (GRCm39) missense possibly damaging 0.89
R7755:Slc6a17 UTSW 3 107,381,671 (GRCm39) missense probably damaging 1.00
R7841:Slc6a17 UTSW 3 107,384,214 (GRCm39) missense possibly damaging 0.69
R7925:Slc6a17 UTSW 3 107,403,056 (GRCm39) missense probably damaging 1.00
R8041:Slc6a17 UTSW 3 107,381,744 (GRCm39) missense probably damaging 1.00
R8305:Slc6a17 UTSW 3 107,380,901 (GRCm39) missense probably benign 0.31
R8306:Slc6a17 UTSW 3 107,380,985 (GRCm39) missense probably benign
R8488:Slc6a17 UTSW 3 107,384,574 (GRCm39) missense possibly damaging 0.84
R8930:Slc6a17 UTSW 3 107,379,507 (GRCm39) missense probably benign 0.19
R8932:Slc6a17 UTSW 3 107,379,507 (GRCm39) missense probably benign 0.19
R9287:Slc6a17 UTSW 3 107,384,551 (GRCm39) missense probably damaging 1.00
R9483:Slc6a17 UTSW 3 107,378,772 (GRCm39) missense possibly damaging 0.50
R9601:Slc6a17 UTSW 3 107,380,930 (GRCm39) missense possibly damaging 0.95
R9617:Slc6a17 UTSW 3 107,384,685 (GRCm39) missense probably damaging 1.00
X0010:Slc6a17 UTSW 3 107,400,422 (GRCm39) missense probably benign 0.05
X0062:Slc6a17 UTSW 3 107,407,684 (GRCm39) missense probably null 1.00
Z1176:Slc6a17 UTSW 3 107,384,082 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATCCAAGGGTGATGTGCTGC -3'
(R):5'- CATCAGTACTGCTACTTGGTGGTG -3'

Sequencing Primer
(F):5'- GTGATGTGCTGCCAGGC -3'
(R):5'- CAAGGGTGGGACAAGATTGGC -3'
Posted On 2016-06-15