Incidental Mutation 'R5048:Lilra6'
ID 394458
Institutional Source Beutler Lab
Gene Symbol Lilra6
Ensembl Gene ENSMUSG00000030427
Gene Name leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 6
Synonyms Pira3, 7M1
MMRRC Submission 042638-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock # R5048 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 3908280-3915503 bp(-) (GRCm38)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 3915441 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000088188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038176] [ENSMUST00000090689] [ENSMUST00000206077]
AlphaFold A0A0B4J1F3
Predicted Effect probably null
Transcript: ENSMUST00000038176
SMART Domains Protein: ENSMUSP00000042636
Gene: ENSMUSG00000030427

DomainStartEndE-ValueType
low complexity region 8 17 N/A INTRINSIC
IG_like 40 105 3.11e0 SMART
IG 129 315 4.53e-2 SMART
IG_like 237 302 1.54e-1 SMART
IG_like 328 415 1.79e1 SMART
IG_like 429 517 2.66e1 SMART
IG 529 618 8.59e-3 SMART
low complexity region 637 646 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000090689
SMART Domains Protein: ENSMUSP00000088188
Gene: ENSMUSG00000030427

DomainStartEndE-ValueType
low complexity region 8 17 N/A INTRINSIC
IG_like 34 118 7.25e0 SMART
IG_like 129 220 1.62e2 SMART
IG_like 290 377 1.79e1 SMART
IG_like 391 479 2.66e1 SMART
IG 491 580 8.59e-3 SMART
low complexity region 599 608 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131255
Predicted Effect probably benign
Transcript: ENSMUST00000206077
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206851
Meta Mutation Damage Score 0.8661 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.1%
Validation Efficiency 98% (64/65)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 T C 2: 69,308,506 I144V probably benign Het
Abhd5 T C 9: 122,377,903 Y85H probably damaging Het
Acadsb G A 7: 131,437,469 G323D probably damaging Het
Amotl2 A G 9: 102,723,798 R322G probably benign Het
Aox1 A T 1: 58,059,482 probably benign Het
Aste1 C T 9: 105,396,989 R82W probably damaging Het
Atg4b T C 1: 93,775,658 I139T possibly damaging Het
Btnl5-ps T A 17: 34,488,723 noncoding transcript Het
Ccdc85c A G 12: 108,221,707 probably null Het
Clasp1 A G 1: 118,547,610 probably benign Het
Defb10 G A 8: 21,861,871 C44Y probably damaging Het
Dhrs9 T C 2: 69,394,400 V144A probably damaging Het
Dnhd1 G C 7: 105,693,697 S1416T probably benign Het
Dok1 T A 6: 83,032,106 probably benign Het
Emilin2 G A 17: 71,273,967 T588M probably damaging Het
Fam181b A G 7: 93,079,939 probably benign Het
Fhad1 T C 4: 141,964,676 probably null Het
Foxi2 A G 7: 135,411,635 E198G probably damaging Het
Fsip2 C A 2: 82,993,150 A6409E probably damaging Het
Gje1 T C 10: 14,717,277 Y65C probably damaging Het
Gm38394 T C 1: 133,658,724 S292G probably damaging Het
Gm6401 T C 14: 41,967,767 probably null Het
Gprc5c T C 11: 114,870,351 *442Q probably null Het
Iars T A 13: 49,688,237 I67N probably damaging Het
Igkv4-79 T C 6: 69,042,987 S115G probably benign Het
Itga4 C A 2: 79,273,034 S156R probably benign Het
Majin C A 19: 6,222,654 A208E probably benign Het
Megf8 A G 7: 25,331,092 Q490R possibly damaging Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Mgarp G A 3: 51,391,286 R88C probably damaging Het
Msh2 T C 17: 87,672,768 F58S probably damaging Het
Nemp1 T C 10: 127,690,935 probably null Het
Nlrp10 A T 7: 108,924,565 N569K probably benign Het
Nxpe2 T C 9: 48,326,088 probably null Het
Olfr1140 C A 2: 87,746,319 A41E probably benign Het
Olfr1204 T C 2: 88,852,463 V171A possibly damaging Het
Pdcd11 C A 19: 47,107,115 S625R probably benign Het
Pigb T A 9: 73,029,708 probably null Het
Pitpnb T C 5: 111,383,003 F221L possibly damaging Het
Prox2 A T 12: 85,094,341 W363R probably damaging Het
Psmg1 T A 16: 95,983,971 R139S probably benign Het
Rab11fip3 A G 17: 26,067,580 probably null Het
Samd9l G A 6: 3,374,157 R1035C probably benign Het
Shkbp1 G A 7: 27,352,096 probably benign Het
Slc30a5 C A 13: 100,806,741 L536F probably damaging Het
Slc6a17 A T 3: 107,471,437 L643* probably null Het
Slit3 T C 11: 35,588,985 Y330H probably damaging Het
St13 G C 15: 81,399,585 R4G probably benign Het
Stoml3 A C 3: 53,500,792 K86N possibly damaging Het
Tmtc1 A T 6: 148,237,846 L926Q possibly damaging Het
Tns4 T G 11: 99,078,779 R285S possibly damaging Het
Uncx C T 5: 139,547,119 T313M probably benign Het
Vmn2r75 G A 7: 86,165,527 R253C possibly damaging Het
Zfp143 A G 7: 110,074,118 T142A probably damaging Het
Zfp287 T C 11: 62,714,951 K366E probably damaging Het
Other mutations in Lilra6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Lilra6 APN 7 3911554 missense probably benign 0.04
IGL00569:Lilra6 APN 7 3914589 missense probably damaging 0.99
IGL00899:Lilra6 APN 7 3913057 missense probably damaging 1.00
IGL00955:Lilra6 APN 7 3911404 splice site probably benign
IGL01585:Lilra6 APN 7 3914499 missense probably benign 0.01
IGL02195:Lilra6 APN 7 3914550 missense probably benign 0.00
IGL02586:Lilra6 APN 7 3908820 missense probably benign 0.36
IGL02719:Lilra6 APN 7 3912992 missense possibly damaging 0.96
IGL03166:Lilra6 APN 7 3912627 missense possibly damaging 0.69
IGL03329:Lilra6 APN 7 3914648 splice site probably benign
R0233:Lilra6 UTSW 7 3914936 missense possibly damaging 0.69
R0233:Lilra6 UTSW 7 3914936 missense possibly damaging 0.69
R0423:Lilra6 UTSW 7 3914775 splice site probably benign
R0483:Lilra6 UTSW 7 3913139 missense probably benign 0.02
R0511:Lilra6 UTSW 7 3912785 missense possibly damaging 0.77
R1472:Lilra6 UTSW 7 3912719 missense probably damaging 1.00
R1560:Lilra6 UTSW 7 3911408 critical splice donor site probably null
R1584:Lilra6 UTSW 7 3912662 missense probably damaging 1.00
R1781:Lilra6 UTSW 7 3915067 missense probably benign 0.28
R2411:Lilra6 UTSW 7 3911454 missense probably damaging 1.00
R2420:Lilra6 UTSW 7 3914858 missense probably damaging 1.00
R4021:Lilra6 UTSW 7 3911418 missense probably benign 0.20
R4074:Lilra6 UTSW 7 3914890 missense probably benign 0.23
R4284:Lilra6 UTSW 7 3908804 missense possibly damaging 0.76
R4508:Lilra6 UTSW 7 3912029 nonsense probably null
R4894:Lilra6 UTSW 7 3912531 missense probably benign 0.01
R4977:Lilra6 UTSW 7 3914383 missense probably benign 0.01
R5164:Lilra6 UTSW 7 3914881 missense probably damaging 1.00
R5185:Lilra6 UTSW 7 3914636 missense probably benign 0.00
R5527:Lilra6 UTSW 7 3914587 start gained probably benign
R6281:Lilra6 UTSW 7 3911973 missense probably damaging 1.00
R6480:Lilra6 UTSW 7 3912933 missense probably damaging 1.00
R6512:Lilra6 UTSW 7 3914388 missense probably benign 0.06
R6565:Lilra6 UTSW 7 3915020 missense probably benign
R7017:Lilra6 UTSW 7 3908708 missense possibly damaging 0.93
R7095:Lilra6 UTSW 7 3913197 missense probably damaging 1.00
R7747:Lilra6 UTSW 7 3912996 missense probably benign 0.16
R8056:Lilra6 UTSW 7 3912552 missense probably damaging 1.00
R8280:Lilra6 UTSW 7 3913047 missense probably benign 0.01
R9197:Lilra6 UTSW 7 3912717 missense possibly damaging 0.94
R9354:Lilra6 UTSW 7 3911629 missense probably damaging 1.00
R9379:Lilra6 UTSW 7 3913167 missense probably damaging 1.00
R9406:Lilra6 UTSW 7 3914854 missense probably benign
Z1176:Lilra6 UTSW 7 3915074 critical splice acceptor site probably null
Z1177:Lilra6 UTSW 7 3912581 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- ATCCAGAGCCTCAGAGTCAGTC -3'
(R):5'- CTGGCCTAGTCACACCATTG -3'

Sequencing Primer
(F):5'- CCTCAGAGTCAGTCCTGGAAGAG -3'
(R):5'- TAGTCACACCATTGAGGAAGTC -3'
Posted On 2016-06-15