Incidental Mutation 'R5048:Foxi2'
ID394467
Institutional Source Beutler Lab
Gene Symbol Foxi2
Ensembl Gene ENSMUSG00000048377
Gene Nameforkhead box I2
SynonymsB130055A05Rik
MMRRC Submission 042638-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5048 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location135410308-135413622 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 135411635 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 198 (E198G)
Ref Sequence ENSEMBL: ENSMUSP00000053641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060356]
Predicted Effect probably damaging
Transcript: ENSMUST00000060356
AA Change: E198G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000053641
Gene: ENSMUSG00000048377
AA Change: E198G

DomainStartEndE-ValueType
low complexity region 64 82 N/A INTRINSIC
low complexity region 87 108 N/A INTRINSIC
FH 115 205 1.29e-58 SMART
low complexity region 207 213 N/A INTRINSIC
low complexity region 237 249 N/A INTRINSIC
low complexity region 262 278 N/A INTRINSIC
Meta Mutation Damage Score 0.1647 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.1%
Validation Efficiency 98% (64/65)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele are viable and fertile with no gross abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 T C 2: 69,308,506 I144V probably benign Het
Abhd5 T C 9: 122,377,903 Y85H probably damaging Het
Acadsb G A 7: 131,437,469 G323D probably damaging Het
Amotl2 A G 9: 102,723,798 R322G probably benign Het
Aox1 A T 1: 58,059,482 probably benign Het
Aste1 C T 9: 105,396,989 R82W probably damaging Het
Atg4b T C 1: 93,775,658 I139T possibly damaging Het
Btnl5-ps T A 17: 34,488,723 noncoding transcript Het
Ccdc85c A G 12: 108,221,707 probably null Het
Clasp1 A G 1: 118,547,610 probably benign Het
Defb10 G A 8: 21,861,871 C44Y probably damaging Het
Dhrs9 T C 2: 69,394,400 V144A probably damaging Het
Dnhd1 G C 7: 105,693,697 S1416T probably benign Het
Dok1 T A 6: 83,032,106 probably benign Het
Emilin2 G A 17: 71,273,967 T588M probably damaging Het
Fam181b A G 7: 93,079,939 probably benign Het
Fhad1 T C 4: 141,964,676 probably null Het
Fsip2 C A 2: 82,993,150 A6409E probably damaging Het
Gje1 T C 10: 14,717,277 Y65C probably damaging Het
Gm38394 T C 1: 133,658,724 S292G probably damaging Het
Gm6401 T C 14: 41,967,767 probably null Het
Gprc5c T C 11: 114,870,351 *442Q probably null Het
Iars T A 13: 49,688,237 I67N probably damaging Het
Igkv4-79 T C 6: 69,042,987 S115G probably benign Het
Itga4 C A 2: 79,273,034 S156R probably benign Het
Lilra6 C T 7: 3,915,441 probably null Het
Majin C A 19: 6,222,654 A208E probably benign Het
Megf8 A G 7: 25,331,092 Q490R possibly damaging Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Mgarp G A 3: 51,391,286 R88C probably damaging Het
Msh2 T C 17: 87,672,768 F58S probably damaging Het
Nemp1 T C 10: 127,690,935 probably null Het
Nlrp10 A T 7: 108,924,565 N569K probably benign Het
Nxpe2 T C 9: 48,326,088 probably null Het
Olfr1140 C A 2: 87,746,319 A41E probably benign Het
Olfr1204 T C 2: 88,852,463 V171A possibly damaging Het
Pdcd11 C A 19: 47,107,115 S625R probably benign Het
Pigb T A 9: 73,029,708 probably null Het
Pitpnb T C 5: 111,383,003 F221L possibly damaging Het
Prox2 A T 12: 85,094,341 W363R probably damaging Het
Psmg1 T A 16: 95,983,971 R139S probably benign Het
Rab11fip3 A G 17: 26,067,580 probably null Het
Samd9l G A 6: 3,374,157 R1035C probably benign Het
Shkbp1 G A 7: 27,352,096 probably benign Het
Slc30a5 C A 13: 100,806,741 L536F probably damaging Het
Slc6a17 A T 3: 107,471,437 L643* probably null Het
Slit3 T C 11: 35,588,985 Y330H probably damaging Het
St13 G C 15: 81,399,585 R4G probably benign Het
Stoml3 A C 3: 53,500,792 K86N possibly damaging Het
Tmtc1 A T 6: 148,237,846 L926Q possibly damaging Het
Tns4 T G 11: 99,078,779 R285S possibly damaging Het
Uncx C T 5: 139,547,119 T313M probably benign Het
Vmn2r75 G A 7: 86,165,527 R253C possibly damaging Het
Zfp143 A G 7: 110,074,118 T142A probably damaging Het
Zfp287 T C 11: 62,714,951 K366E probably damaging Het
Other mutations in Foxi2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01101:Foxi2 APN 7 135412007 missense probably benign 0.07
IGL02984:Foxi2 UTSW 7 135410398 missense possibly damaging 0.96
R0030:Foxi2 UTSW 7 135411616 missense probably damaging 0.99
R0030:Foxi2 UTSW 7 135411616 missense probably damaging 0.99
R0121:Foxi2 UTSW 7 135411911 missense probably benign
R0830:Foxi2 UTSW 7 135411730 missense probably benign
R2059:Foxi2 UTSW 7 135410677 missense probably damaging 1.00
R3615:Foxi2 UTSW 7 135410451 missense possibly damaging 0.88
R3616:Foxi2 UTSW 7 135410451 missense possibly damaging 0.88
R4021:Foxi2 UTSW 7 135410530 missense probably damaging 1.00
R4764:Foxi2 UTSW 7 135410667 missense probably damaging 1.00
R5257:Foxi2 UTSW 7 135410527 missense probably benign 0.19
R5258:Foxi2 UTSW 7 135410527 missense probably benign 0.19
R5561:Foxi2 UTSW 7 135411647 missense probably damaging 1.00
R5611:Foxi2 UTSW 7 135411704 missense probably benign 0.00
R5667:Foxi2 UTSW 7 135410939 splice site probably null
R7492:Foxi2 UTSW 7 135410572 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCACCCAAATTCTTGCAGTCTG -3'
(R):5'- GAAAAGTCATGGGCCAGACC -3'

Sequencing Primer
(F):5'- GACTGTGGAGGCCTATTCCCAAC -3'
(R):5'- TCCCATGGCCGTGGAGAAG -3'
Posted On2016-06-15