Mutagenetix > Incidental Mutations

Incidental Mutation 'R5048:Gprc5c'

394479

Institutional Source

Beutler Lab

Gene Symbol

Gprc5c

Ensembl Gene

ENSMUSG00000051043

Gene Name

G protein-coupled receptor, family C, group 5, member C

Synonyms

MMRRC Submission

042638-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.302) question?

Stock #

R5048 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

114851152-114872617 bp(+) (GRCm38)

Type of Mutation

makesense

DNA Base Change (assembly)

T to C at 114870351 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Stop codon to Glutamine at position 442 (*442Q)

Ref Sequence

ENSEMBL: ENSMUSP00000061760 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021071] [ENSMUST00000053361] [ENSMUST00000122967] [ENSMUST00000152314] [ENSMUST00000177952]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000021071

SMART Domains

Protein: ENSMUSP00000021071
Gene: ENSMUSG00000051043

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:7tm_3	58	302	1.3e-42	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000053361
AA Change: *442Q

SMART Domains

Protein: ENSMUSP00000061760
Gene: ENSMUSG00000051043
AA Change: *442Q

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:7tm_3	60	301	1.3e-28	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000122967

SMART Domains

Protein: ENSMUSP00000114335
Gene: ENSMUSG00000051043

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
transmembrane domain	55	77	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000152314

Predicted Effect

probably benign
Transcript: ENSMUST00000177952

SMART Domains

Protein: ENSMUSP00000136702
Gene: ENSMUSG00000051043

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:7tm_3	58	302	1.3e-42	PFAM

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.2%
20x: 92.1%

Validation Efficiency

98% (64/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the type 3 G protein-coupled receptor family. Members of this superfamily are characterized by a signature 7-transmembrane domain motif. The specific function of this protein is unknown; however, this protein may mediate the cellular effects of retinoic acid on the G protein signal transduction cascade. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a reporter allele are behaviorally normal but exhibit reticulocytosis, increased mean corpuscular volume, increased percentage of basophils, decreased mean corpuscular hemogloblin concentration, and increased alkaline phophatase and lactic dehydrogenase levels. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb11	T	C	2: 69,308,506	I144V	probably benign	Het
Abhd5	T	C	9: 122,377,903	Y85H	probably damaging	Het
Acadsb	G	A	7: 131,437,469	G323D	probably damaging	Het
Amotl2	A	G	9: 102,723,798	R322G	probably benign	Het
Aox1	A	T	1: 58,059,482		probably benign	Het
Aste1	C	T	9: 105,396,989	R82W	probably damaging	Het
Atg4b	T	C	1: 93,775,658	I139T	possibly damaging	Het
Btnl5-ps	T	A	17: 34,488,723		noncoding transcript	Het
Ccdc85c	A	G	12: 108,221,707		probably null	Het
Clasp1	A	G	1: 118,547,610		probably benign	Het
Defb10	G	A	8: 21,861,871	C44Y	probably damaging	Het
Dhrs9	T	C	2: 69,394,400	V144A	probably damaging	Het
Dnhd1	G	C	7: 105,693,697	S1416T	probably benign	Het
Dok1	T	A	6: 83,032,106		probably benign	Het
Emilin2	G	A	17: 71,273,967	T588M	probably damaging	Het
Fam181b	A	G	7: 93,079,939		probably benign	Het
Fhad1	T	C	4: 141,964,676		probably null	Het
Foxi2	A	G	7: 135,411,635	E198G	probably damaging	Het
Fsip2	C	A	2: 82,993,150	A6409E	probably damaging	Het
Gje1	T	C	10: 14,717,277	Y65C	probably damaging	Het
Gm38394	T	C	1: 133,658,724	S292G	probably damaging	Het
Gm6401	T	C	14: 41,967,767		probably null	Het
Iars	T	A	13: 49,688,237	I67N	probably damaging	Het
Igkv4-79	T	C	6: 69,042,987	S115G	probably benign	Het
Itga4	C	A	2: 79,273,034	S156R	probably benign	Het
Lilra6	C	T	7: 3,915,441		probably null	Het
Majin	C	A	19: 6,222,654	A208E	probably benign	Het
Megf8	A	G	7: 25,331,092	Q490R	possibly damaging	Het
Mfng	C	T	15: 78,764,388	R163H	probably benign	Het
Mgarp	G	A	3: 51,391,286	R88C	probably damaging	Het
Msh2	T	C	17: 87,672,768	F58S	probably damaging	Het
Nemp1	T	C	10: 127,690,935		probably null	Het
Nlrp10	A	T	7: 108,924,565	N569K	probably benign	Het
Nxpe2	T	C	9: 48,326,088		probably null	Het
Olfr1140	C	A	2: 87,746,319	A41E	probably benign	Het
Olfr1204	T	C	2: 88,852,463	V171A	possibly damaging	Het
Pdcd11	C	A	19: 47,107,115	S625R	probably benign	Het
Pigb	T	A	9: 73,029,708		probably null	Het
Pitpnb	T	C	5: 111,383,003	F221L	possibly damaging	Het
Prox2	A	T	12: 85,094,341	W363R	probably damaging	Het
Psmg1	T	A	16: 95,983,971	R139S	probably benign	Het
Rab11fip3	A	G	17: 26,067,580		probably null	Het
Samd9l	G	A	6: 3,374,157	R1035C	probably benign	Het
Shkbp1	G	A	7: 27,352,096		probably benign	Het
Slc30a5	C	A	13: 100,806,741	L536F	probably damaging	Het
Slc6a17	A	T	3: 107,471,437	L643*	probably null	Het
Slit3	T	C	11: 35,588,985	Y330H	probably damaging	Het
St13	G	C	15: 81,399,585	R4G	probably benign	Het
Stoml3	A	C	3: 53,500,792	K86N	possibly damaging	Het
Tmtc1	A	T	6: 148,237,846	L926Q	possibly damaging	Het
Tns4	T	G	11: 99,078,779	R285S	possibly damaging	Het
Uncx	C	T	5: 139,547,119	T313M	probably benign	Het
Vmn2r75	G	A	7: 86,165,527	R253C	possibly damaging	Het
Zfp143	A	G	7: 110,074,118	T142A	probably damaging	Het
Zfp287	T	C	11: 62,714,951	K366E	probably damaging	Het

Other mutations in Gprc5c

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01599:Gprc5c	APN	11	114864252	missense	probably benign	0.01
IGL01762:Gprc5c	APN	11	114864024	missense	probably benign	0.28
IGL02039:Gprc5c	APN	11	114864486	nonsense	probably null
R0800:Gprc5c	UTSW	11	114866711	missense	probably damaging	0.99
R1618:Gprc5c	UTSW	11	114864394	missense	possibly damaging	0.88
R4198:Gprc5c	UTSW	11	114863860	missense	probably damaging	1.00
R4807:Gprc5c	UTSW	11	114864498	missense	probably damaging	0.97
R4846:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R4902:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R4904:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5016:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5106:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5109:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5173:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5266:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5267:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5475:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5508:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5557:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5562:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5563:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5598:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5599:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5729:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5756:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5792:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5793:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5794:Gprc5c	UTSW	11	114864267	missense	possibly damaging	0.92
R5817:Gprc5c	UTSW	11	114863624	nonsense	probably null
R5976:Gprc5c	UTSW	11	114864487	missense	possibly damaging	0.89
R6151:Gprc5c	UTSW	11	114864025	missense	probably damaging	1.00
R6617:Gprc5c	UTSW	11	114864105	missense	probably benign	0.05
R7108:Gprc5c	UTSW	11	114864282	missense	probably damaging	1.00
R7191:Gprc5c	UTSW	11	114868617	missense	possibly damaging	0.56
R7796:Gprc5c	UTSW	11	114864532	missense	probably damaging	0.97
R8543:Gprc5c	UTSW	11	114864268	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCAGACTTCTCCAAACGTC -3'
(R):5'- TGCAGTTTCTTGGATACCAGG -3'

Sequencing Primer
(F):5'- CGTCTATATTTAGATGGCATTGCTC -3'
(R):5'- ATGAGCACCAGTCACATATTTCAGG -3'

Posted On

2016-06-15