Incidental Mutation 'R5049:Aamp'
ID394495
Institutional Source Beutler Lab
Gene Symbol Aamp
Ensembl Gene ENSMUSG00000006299
Gene Nameangio-associated migratory protein
SynonymsAamp-rs
MMRRC Submission 042639-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R5049 (G1)
Quality Score162
Status Validated
Chromosome1
Chromosomal Location74279840-74284738 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 74282539 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 76 (S76P)
Ref Sequence ENSEMBL: ENSMUSP00000139411 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006462] [ENSMUST00000027370] [ENSMUST00000077985] [ENSMUST00000087226] [ENSMUST00000113805] [ENSMUST00000178235] [ENSMUST00000187046] [ENSMUST00000190008]
Predicted Effect probably damaging
Transcript: ENSMUST00000006462
AA Change: S137P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000006462
Gene: ENSMUSG00000006299
AA Change: S137P

DomainStartEndE-ValueType
low complexity region 34 42 N/A INTRINSIC
low complexity region 46 64 N/A INTRINSIC
WD40 81 121 2.76e-2 SMART
WD40 124 163 4.83e-7 SMART
WD40 166 203 7.96e0 SMART
WD40 205 244 2.51e-5 SMART
WD40 247 289 2.38e-6 SMART
WD40 292 346 2.47e1 SMART
WD40 349 387 2.61e-3 SMART
WD40 390 429 1.75e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000027370
SMART Domains Protein: ENSMUSP00000027370
Gene: ENSMUSG00000026179

DomainStartEndE-ValueType
Blast:Lactamase_B 4 79 1e-24 BLAST
Lactamase_B 129 291 1.05e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000077985
SMART Domains Protein: ENSMUSP00000077135
Gene: ENSMUSG00000064272

DomainStartEndE-ValueType
Pfam:7tm_1 30 264 7.2e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000087226
SMART Domains Protein: ENSMUSP00000084478
Gene: ENSMUSG00000026179

DomainStartEndE-ValueType
low complexity region 43 61 N/A INTRINSIC
Pfam:DUF4748 71 121 2.9e-23 PFAM
Lactamase_B 168 330 1.05e-31 SMART
Pfam:HAGH_C 331 421 6.2e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113805
SMART Domains Protein: ENSMUSP00000109436
Gene: ENSMUSG00000026179

DomainStartEndE-ValueType
Blast:Lactamase_B 4 79 4e-28 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129219
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138620
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152492
Predicted Effect probably damaging
Transcript: ENSMUST00000178235
AA Change: S138P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136644
Gene: ENSMUSG00000006299
AA Change: S138P

DomainStartEndE-ValueType
low complexity region 33 45 N/A INTRINSIC
low complexity region 47 65 N/A INTRINSIC
WD40 82 122 2.76e-2 SMART
WD40 125 164 4.83e-7 SMART
WD40 167 204 7.96e0 SMART
WD40 206 245 2.51e-5 SMART
WD40 248 290 2.38e-6 SMART
WD40 293 347 2.47e1 SMART
WD40 350 388 2.61e-3 SMART
WD40 391 430 1.75e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186833
Predicted Effect probably damaging
Transcript: ENSMUST00000187046
AA Change: S76P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139411
Gene: ENSMUSG00000006299
AA Change: S76P

DomainStartEndE-ValueType
WD40 20 60 1.7e-4 SMART
WD40 63 102 3e-9 SMART
WD40 120 160 1.7e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187908
Predicted Effect probably benign
Transcript: ENSMUST00000190008
SMART Domains Protein: ENSMUSP00000140427
Gene: ENSMUSG00000006299

DomainStartEndE-ValueType
low complexity region 17 34 N/A INTRINSIC
low complexity region 40 58 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191258
Meta Mutation Damage Score 0.9063 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 95.8%
  • 20x: 90.4%
Validation Efficiency 97% (89/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene is a member of the immunoglobulin superfamily. The encoded protein is associated with angiogenesis, with potential roles in endothelial tube formation and the migration of endothelial cells. It may also regulate smooth muscle cell migration via the RhoA pathway. The encoded protein can bind to heparin and may mediate heparin-sensitive cell adhesion. [provided by RefSeq, Oct 2014]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810013L24Rik T A 16: 8,843,209 D183E probably damaging Het
4932438A13Rik T A 3: 37,040,506 probably benign Het
4932438A13Rik T C 3: 37,041,390 M1016T probably damaging Het
9330182L06Rik A G 5: 9,428,488 T451A probably damaging Het
Acot8 A G 2: 164,799,690 probably benign Het
Angptl7 A G 4: 148,498,011 F143L probably benign Het
Atxn7l1 A G 12: 33,358,687 T283A probably benign Het
Brd3 G T 2: 27,450,577 probably benign Het
C130026L21Rik T A 5: 111,581,836 noncoding transcript Het
Cbr4 T G 8: 61,495,204 probably null Het
Ccl19 A G 4: 42,756,268 probably null Het
Ccl2 G T 11: 82,036,507 C34F probably damaging Het
Dnah12 A T 14: 26,735,697 T873S probably benign Het
Dnah2 T C 11: 69,448,166 N3118S probably damaging Het
Epb41l1 C A 2: 156,524,939 P564Q possibly damaging Het
Extl3 A T 14: 65,076,032 M567K probably benign Het
Fam160b1 T C 19: 57,386,305 I704T possibly damaging Het
Fam208b A T 13: 3,574,000 H1983Q probably benign Het
Foxf2 T C 13: 31,627,175 S366P probably benign Het
Gamt T A 10: 80,258,954 T186S probably benign Het
Gcn1l1 T A 5: 115,606,671 M1642K probably damaging Het
Gm21738 T A 14: 19,415,957 Y194F probably benign Het
Golga1 A T 2: 39,047,735 M115K probably damaging Het
Herc3 A G 6: 58,894,539 probably null Het
Hes2 C A 4: 152,159,874 L39I possibly damaging Het
Hopx C A 5: 77,095,052 probably benign Het
Idi1 C T 13: 8,888,042 P175S probably damaging Het
Ifit1bl1 A T 19: 34,594,081 C325* probably null Het
Ighv7-3 T C 12: 114,153,333 I70V probably benign Het
Kcnq3 T C 15: 66,285,897 T110A probably benign Het
Kif5a T C 10: 127,239,839 D451G possibly damaging Het
Lama3 A G 18: 12,582,611 E1708G probably benign Het
Lrriq4 T A 3: 30,650,937 D371E probably damaging Het
Lyst T A 13: 13,636,064 V773E probably damaging Het
Map4 T A 9: 110,079,814 L23* probably null Het
Mapkbp1 G T 2: 120,015,501 probably benign Het
Mrpl30 A T 1: 37,897,710 D52V possibly damaging Het
Olfr1122 A T 2: 87,388,658 T318S probably benign Het
Olfr71 A T 4: 43,706,259 L103Q probably damaging Het
Pard3b T A 1: 62,161,161 H286Q probably benign Het
Parp4 A G 14: 56,635,731 K1144R possibly damaging Het
Pdcd11 C A 19: 47,107,115 S625R probably benign Het
Pkhd1l1 T C 15: 44,457,616 S22P probably benign Het
Prss32 A T 17: 23,859,247 E302D possibly damaging Het
Prss45 A G 9: 110,840,470 K205E probably damaging Het
Puf60 T A 15: 76,070,474 I500F probably damaging Het
Ryr3 A T 2: 112,640,171 I4623N probably damaging Het
Sh3bp5l T A 11: 58,338,124 probably benign Het
Slc3a1 T G 17: 85,032,845 Y232D probably damaging Het
Slc8a3 A G 12: 81,214,132 Y608H probably damaging Het
Socs7 G T 11: 97,378,643 R429L probably benign Het
Sorcs3 C A 19: 48,759,951 N786K possibly damaging Het
Sp4 A T 12: 118,254,472 M680K probably benign Het
Tas2r131 T C 6: 132,957,577 T90A probably damaging Het
Tbx21 T C 11: 97,114,710 H143R probably benign Het
Tg T A 15: 66,827,382 C833* probably null Het
Tmem245 A G 4: 56,925,057 S355P probably benign Het
Tmem86b G A 7: 4,628,466 P191S possibly damaging Het
Tnc A G 4: 64,017,986 C238R probably damaging Het
Tnn T A 1: 160,140,738 E361D probably benign Het
Tpp2 T C 1: 44,001,473 V298A possibly damaging Het
Trav7-6 A G 14: 53,717,079 N22S probably damaging Het
Trim75 T C 8: 64,982,439 probably null Het
Trrap T A 5: 144,826,717 I2492N probably damaging Het
Ufl1 G T 4: 25,254,773 A561E probably benign Het
Uqcc1 A G 2: 155,910,421 V86A probably damaging Het
Vmn1r184 A G 7: 26,267,368 I180V possibly damaging Het
Vmn1r185 A G 7: 26,611,495 F195S possibly damaging Het
Vmn2r4 A C 3: 64,398,598 probably null Het
Vmn2r87 T C 10: 130,472,429 T647A probably damaging Het
Vps13d A T 4: 145,086,766 H198Q probably damaging Het
Wdfy4 T C 14: 33,152,670 T154A possibly damaging Het
Xirp2 A G 2: 67,517,134 M3240V probably benign Het
Zfp101 T C 17: 33,381,898 R295G possibly damaging Het
Zfp619 G A 7: 39,535,514 V323I probably benign Het
Zfy1 A T Y: 726,004 I587N possibly damaging Het
Zswim6 C T 13: 107,726,575 noncoding transcript Het
Other mutations in Aamp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Aamp APN 1 74281436 unclassified probably benign
IGL02476:Aamp APN 1 74281524 unclassified probably benign
R0960:Aamp UTSW 1 74281145 missense possibly damaging 0.77
R1590:Aamp UTSW 1 74283211 missense probably damaging 1.00
R2138:Aamp UTSW 1 74283963 missense probably benign 0.00
R4112:Aamp UTSW 1 74281227 unclassified probably benign
R4223:Aamp UTSW 1 74281126 missense probably damaging 0.98
R5283:Aamp UTSW 1 74284006 missense possibly damaging 0.49
R6353:Aamp UTSW 1 74280828 missense probably benign 0.37
R6526:Aamp UTSW 1 74284172 critical splice donor site probably null
R6683:Aamp UTSW 1 74282445 missense possibly damaging 0.76
R6884:Aamp UTSW 1 74284248 unclassified probably benign
R7141:Aamp UTSW 1 74284111 intron probably null
Predicted Primers PCR Primer
(F):5'- GCAAACTTCTCCAGGCTAGATC -3'
(R):5'- ATGGGTCACTTGTCCCCAAC -3'

Sequencing Primer
(F):5'- AGGCTAGATCTGGATCCGTC -3'
(R):5'- GGGTCACTTGTCCCCAACATTTAG -3'
Posted On2016-06-15