Incidental Mutation 'R5049:Mapkbp1'
ID394502
Institutional Source Beutler Lab
Gene Symbol Mapkbp1
Ensembl Gene ENSMUSG00000033902
Gene Namemitogen-activated protein kinase binding protein 1
Synonyms2810483F24Rik, Jnkbp1
MMRRC Submission 042639-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5049 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location119972699-120027408 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to T at 120015501 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000155163 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066058] [ENSMUST00000229024]
Predicted Effect probably benign
Transcript: ENSMUST00000066058
SMART Domains Protein: ENSMUSP00000068516
Gene: ENSMUSG00000033902

DomainStartEndE-ValueType
WD40 80 121 8.75e-5 SMART
WD40 124 165 3.64e-2 SMART
WD40 168 205 4.62e-1 SMART
low complexity region 220 234 N/A INTRINSIC
WD40 264 301 2.65e1 SMART
WD40 332 367 1.99e0 SMART
WD40 374 422 1.29e-2 SMART
WD40 463 502 3.9e-2 SMART
WD40 505 547 2.77e-1 SMART
WD40 551 592 2.67e-1 SMART
WD40 599 639 2.21e1 SMART
WD40 642 684 5.75e-1 SMART
WD40 687 726 6.04e-8 SMART
low complexity region 736 747 N/A INTRINSIC
low complexity region 779 795 N/A INTRINSIC
low complexity region 1028 1054 N/A INTRINSIC
coiled coil region 1400 1427 N/A INTRINSIC
low complexity region 1460 1477 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128077
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137760
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184907
Predicted Effect probably benign
Transcript: ENSMUST00000229024
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 95.8%
  • 20x: 90.4%
Validation Efficiency 97% (89/92)
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810013L24Rik T A 16: 8,843,209 D183E probably damaging Het
4932438A13Rik T A 3: 37,040,506 probably benign Het
4932438A13Rik T C 3: 37,041,390 M1016T probably damaging Het
9330182L06Rik A G 5: 9,428,488 T451A probably damaging Het
Aamp A G 1: 74,282,539 S76P probably damaging Het
Acot8 A G 2: 164,799,690 probably benign Het
Angptl7 A G 4: 148,498,011 F143L probably benign Het
Atxn7l1 A G 12: 33,358,687 T283A probably benign Het
Brd3 G T 2: 27,450,577 probably benign Het
C130026L21Rik T A 5: 111,581,836 noncoding transcript Het
Cbr4 T G 8: 61,495,204 probably null Het
Ccl19 A G 4: 42,756,268 probably null Het
Ccl2 G T 11: 82,036,507 C34F probably damaging Het
Dnah12 A T 14: 26,735,697 T873S probably benign Het
Dnah2 T C 11: 69,448,166 N3118S probably damaging Het
Epb41l1 C A 2: 156,524,939 P564Q possibly damaging Het
Extl3 A T 14: 65,076,032 M567K probably benign Het
Fam160b1 T C 19: 57,386,305 I704T possibly damaging Het
Fam208b A T 13: 3,574,000 H1983Q probably benign Het
Foxf2 T C 13: 31,627,175 S366P probably benign Het
Gamt T A 10: 80,258,954 T186S probably benign Het
Gcn1l1 T A 5: 115,606,671 M1642K probably damaging Het
Gm21738 T A 14: 19,415,957 Y194F probably benign Het
Golga1 A T 2: 39,047,735 M115K probably damaging Het
Herc3 A G 6: 58,894,539 probably null Het
Hes2 C A 4: 152,159,874 L39I possibly damaging Het
Hopx C A 5: 77,095,052 probably benign Het
Idi1 C T 13: 8,888,042 P175S probably damaging Het
Ifit1bl1 A T 19: 34,594,081 C325* probably null Het
Ighv7-3 T C 12: 114,153,333 I70V probably benign Het
Kcnq3 T C 15: 66,285,897 T110A probably benign Het
Kif5a T C 10: 127,239,839 D451G possibly damaging Het
Lama3 A G 18: 12,582,611 E1708G probably benign Het
Lrriq4 T A 3: 30,650,937 D371E probably damaging Het
Lyst T A 13: 13,636,064 V773E probably damaging Het
Map4 T A 9: 110,079,814 L23* probably null Het
Mrpl30 A T 1: 37,897,710 D52V possibly damaging Het
Olfr1122 A T 2: 87,388,658 T318S probably benign Het
Olfr71 A T 4: 43,706,259 L103Q probably damaging Het
Pard3b T A 1: 62,161,161 H286Q probably benign Het
Parp4 A G 14: 56,635,731 K1144R possibly damaging Het
Pdcd11 C A 19: 47,107,115 S625R probably benign Het
Pkhd1l1 T C 15: 44,457,616 S22P probably benign Het
Prss32 A T 17: 23,859,247 E302D possibly damaging Het
Prss45 A G 9: 110,840,470 K205E probably damaging Het
Puf60 T A 15: 76,070,474 I500F probably damaging Het
Ryr3 A T 2: 112,640,171 I4623N probably damaging Het
Sh3bp5l T A 11: 58,338,124 probably benign Het
Slc3a1 T G 17: 85,032,845 Y232D probably damaging Het
Slc8a3 A G 12: 81,214,132 Y608H probably damaging Het
Socs7 G T 11: 97,378,643 R429L probably benign Het
Sorcs3 C A 19: 48,759,951 N786K possibly damaging Het
Sp4 A T 12: 118,254,472 M680K probably benign Het
Tas2r131 T C 6: 132,957,577 T90A probably damaging Het
Tbx21 T C 11: 97,114,710 H143R probably benign Het
Tg T A 15: 66,827,382 C833* probably null Het
Tmem245 A G 4: 56,925,057 S355P probably benign Het
Tmem86b G A 7: 4,628,466 P191S possibly damaging Het
Tnc A G 4: 64,017,986 C238R probably damaging Het
Tnn T A 1: 160,140,738 E361D probably benign Het
Tpp2 T C 1: 44,001,473 V298A possibly damaging Het
Trav7-6 A G 14: 53,717,079 N22S probably damaging Het
Trim75 T C 8: 64,982,439 probably null Het
Trrap T A 5: 144,826,717 I2492N probably damaging Het
Ufl1 G T 4: 25,254,773 A561E probably benign Het
Uqcc1 A G 2: 155,910,421 V86A probably damaging Het
Vmn1r184 A G 7: 26,267,368 I180V possibly damaging Het
Vmn1r185 A G 7: 26,611,495 F195S possibly damaging Het
Vmn2r4 A C 3: 64,398,598 probably null Het
Vmn2r87 T C 10: 130,472,429 T647A probably damaging Het
Vps13d A T 4: 145,086,766 H198Q probably damaging Het
Wdfy4 T C 14: 33,152,670 T154A possibly damaging Het
Xirp2 A G 2: 67,517,134 M3240V probably benign Het
Zfp101 T C 17: 33,381,898 R295G possibly damaging Het
Zfp619 G A 7: 39,535,514 V323I probably benign Het
Zfy1 A T Y: 726,004 I587N possibly damaging Het
Zswim6 C T 13: 107,726,575 noncoding transcript Het
Other mutations in Mapkbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01102:Mapkbp1 APN 2 120021858 missense possibly damaging 0.94
IGL01309:Mapkbp1 APN 2 120018942 missense probably damaging 1.00
IGL01728:Mapkbp1 APN 2 120023821 missense probably damaging 1.00
IGL01808:Mapkbp1 APN 2 120023169 unclassified probably null
IGL02185:Mapkbp1 APN 2 120014663 missense possibly damaging 0.58
IGL02421:Mapkbp1 APN 2 120019655 missense possibly damaging 0.95
IGL02691:Mapkbp1 APN 2 119973174 splice site probably benign
IGL03146:Mapkbp1 APN 2 119998474 splice site probably benign
IGL03387:Mapkbp1 APN 2 119998498 missense probably damaging 0.99
IGL03054:Mapkbp1 UTSW 2 120015400 missense probably damaging 0.97
R0118:Mapkbp1 UTSW 2 120025215 missense probably benign 0.00
R0393:Mapkbp1 UTSW 2 120012903 splice site probably null
R0463:Mapkbp1 UTSW 2 120023151 missense probably benign 0.01
R0788:Mapkbp1 UTSW 2 120024001 missense probably benign 0.02
R0928:Mapkbp1 UTSW 2 120015368 missense probably benign 0.00
R1104:Mapkbp1 UTSW 2 120011073 splice site probably benign
R1162:Mapkbp1 UTSW 2 120025318 missense possibly damaging 0.87
R1219:Mapkbp1 UTSW 2 120019350 nonsense probably null
R1299:Mapkbp1 UTSW 2 120015404 missense probably damaging 1.00
R1300:Mapkbp1 UTSW 2 120013655 missense probably benign 0.25
R1342:Mapkbp1 UTSW 2 119998534 missense possibly damaging 0.95
R1456:Mapkbp1 UTSW 2 119973145 missense probably damaging 1.00
R1464:Mapkbp1 UTSW 2 120021261 missense probably benign
R1464:Mapkbp1 UTSW 2 120021261 missense probably benign
R1470:Mapkbp1 UTSW 2 120017820 missense probably damaging 1.00
R1470:Mapkbp1 UTSW 2 120017820 missense probably damaging 1.00
R1660:Mapkbp1 UTSW 2 120018548 missense possibly damaging 0.83
R2008:Mapkbp1 UTSW 2 120012665 missense probably damaging 1.00
R2083:Mapkbp1 UTSW 2 120015482 missense possibly damaging 0.96
R2371:Mapkbp1 UTSW 2 120010780 missense probably damaging 1.00
R2423:Mapkbp1 UTSW 2 120024590 missense probably benign 0.00
R3976:Mapkbp1 UTSW 2 120021858 missense possibly damaging 0.94
R4009:Mapkbp1 UTSW 2 120023605 missense probably benign 0.00
R4183:Mapkbp1 UTSW 2 120017865 missense probably damaging 1.00
R4246:Mapkbp1 UTSW 2 120013027 missense probably damaging 1.00
R4503:Mapkbp1 UTSW 2 120015706 missense probably damaging 1.00
R4513:Mapkbp1 UTSW 2 120023693 missense possibly damaging 0.63
R4517:Mapkbp1 UTSW 2 120025064 intron probably benign
R4742:Mapkbp1 UTSW 2 120016818 missense probably damaging 1.00
R5079:Mapkbp1 UTSW 2 120013733 missense probably damaging 0.99
R5137:Mapkbp1 UTSW 2 120022181 missense probably damaging 1.00
R5255:Mapkbp1 UTSW 2 120017254 missense probably damaging 1.00
R5530:Mapkbp1 UTSW 2 120015355 missense probably benign
R5546:Mapkbp1 UTSW 2 120019243 missense probably damaging 1.00
R5634:Mapkbp1 UTSW 2 119973095 missense probably damaging 1.00
R5696:Mapkbp1 UTSW 2 120021720 splice site probably null
R5891:Mapkbp1 UTSW 2 120023932 nonsense probably null
R6263:Mapkbp1 UTSW 2 120023291 missense probably damaging 1.00
R6807:Mapkbp1 UTSW 2 120021159 missense probably damaging 0.99
R6890:Mapkbp1 UTSW 2 120015802 missense probably damaging 1.00
R7159:Mapkbp1 UTSW 2 120025132 missense possibly damaging 0.72
R7467:Mapkbp1 UTSW 2 120022188 missense probably damaging 1.00
R7536:Mapkbp1 UTSW 2 120018585 missense probably damaging 1.00
R7564:Mapkbp1 UTSW 2 120013751 missense probably benign 0.09
R7801:Mapkbp1 UTSW 2 120012073 missense probably damaging 1.00
R7886:Mapkbp1 UTSW 2 120012647 missense possibly damaging 0.90
R7969:Mapkbp1 UTSW 2 120012647 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GCGGAAGTCTAATTCTCTCCC -3'
(R):5'- AAGCCTGAGTGTTCCCATCC -3'

Sequencing Primer
(F):5'- GGAAGTCTAATTCTCTCCCTCTGTC -3'
(R):5'- GAGTGTTCCCATCCACATAGATG -3'
Posted On2016-06-15