Incidental Mutation 'R5049:Tnc'
ID394513
Institutional Source Beutler Lab
Gene Symbol Tnc
Ensembl Gene ENSMUSG00000028364
Gene Nametenascin C
SynonymsTN, TN-C, hexabrachion, tenascin-C, C130033P17Rik, cytotactin, Hxb
MMRRC Submission 042639-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5049 (G1)
Quality Score209
Status Validated
Chromosome4
Chromosomal Location63959785-64047015 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 64017986 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 238 (C238R)
Ref Sequence ENSEMBL: ENSMUSP00000102994 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030056] [ENSMUST00000107371] [ENSMUST00000107372] [ENSMUST00000107377]
Predicted Effect probably damaging
Transcript: ENSMUST00000030056
AA Change: C238R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030056
Gene: ENSMUSG00000028364
AA Change: C238R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 121 138 N/A INTRINSIC
EGF 189 217 1.87e1 SMART
EGF_like 220 248 3.5e1 SMART
EGF 251 280 4.89e0 SMART
EGF 283 311 3.23e0 SMART
EGF_like 314 342 2.98e1 SMART
EGF 345 373 1.87e1 SMART
EGF 376 404 3.97e0 SMART
EGF 407 435 8.52e0 SMART
EGF 438 466 3.01e0 SMART
EGF 469 497 3.46e0 SMART
EGF 500 528 3.71e0 SMART
EGF 531 559 4.32e-1 SMART
EGF 562 590 1.84e1 SMART
EGF 593 621 3.82e-2 SMART
FN3 623 701 8.9e-8 SMART
FN3 712 794 1.53e-6 SMART
FN3 803 884 7.23e-8 SMART
FN3 893 974 1.71e-9 SMART
FN3 985 1062 2.56e-8 SMART
FN3 1074 1152 8.58e-1 SMART
FN3 1165 1245 2.72e-3 SMART
FN3 1256 1334 5.36e-2 SMART
FN3 1347 1427 4.93e0 SMART
FN3 1438 1517 3.4e-4 SMART
FN3 1528 1606 1.55e-7 SMART
FN3 1617 1694 1.53e-6 SMART
FN3 1705 1782 7.75e-8 SMART
FBG 1797 2007 4.08e-124 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107371
AA Change: C238R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102994
Gene: ENSMUSG00000028364
AA Change: C238R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 121 138 N/A INTRINSIC
Pfam:hEGF 173 185 4e-4 PFAM
EGF 189 217 1.87e1 SMART
EGF_like 220 248 3.5e1 SMART
EGF 251 280 4.89e0 SMART
EGF 283 311 3.23e0 SMART
EGF_like 314 342 2.98e1 SMART
EGF 345 373 1.87e1 SMART
EGF 376 404 3.97e0 SMART
EGF 407 435 8.52e0 SMART
EGF 438 466 3.01e0 SMART
EGF 469 497 3.46e0 SMART
EGF 500 528 3.71e0 SMART
EGF 531 559 4.32e-1 SMART
EGF 562 590 1.84e1 SMART
EGF 593 621 3.82e-2 SMART
FN3 623 701 8.9e-8 SMART
FN3 712 794 1.53e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107372
AA Change: C238R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102995
Gene: ENSMUSG00000028364
AA Change: C238R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 121 138 N/A INTRINSIC
EGF 189 217 1.87e1 SMART
EGF_like 220 248 3.5e1 SMART
EGF 251 280 4.89e0 SMART
EGF 283 311 3.23e0 SMART
EGF_like 314 342 2.98e1 SMART
EGF 345 373 1.87e1 SMART
EGF 376 404 3.97e0 SMART
EGF 407 435 8.52e0 SMART
EGF 438 466 3.01e0 SMART
EGF 469 497 3.46e0 SMART
EGF 500 528 3.71e0 SMART
EGF 531 559 4.32e-1 SMART
EGF 562 590 1.84e1 SMART
EGF 593 621 3.82e-2 SMART
FN3 623 701 8.9e-8 SMART
FN3 712 794 1.53e-6 SMART
FN3 803 884 7.23e-8 SMART
FN3 893 974 1.71e-9 SMART
FN3 985 1062 2.56e-8 SMART
FN3 1074 1152 8.58e-1 SMART
FN3 1165 1245 2.72e-3 SMART
FN3 1256 1334 5.36e-2 SMART
FN3 1347 1427 4.93e0 SMART
FN3 1438 1517 2.75e0 SMART
FN3 1529 1608 3.4e-4 SMART
FN3 1619 1697 1.55e-7 SMART
FN3 1708 1785 1.53e-6 SMART
FN3 1796 1873 7.75e-8 SMART
FBG 1888 2098 4.08e-124 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107377
AA Change: C238R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103000
Gene: ENSMUSG00000028364
AA Change: C238R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 121 138 N/A INTRINSIC
EGF 189 217 1.87e1 SMART
EGF_like 220 248 3.5e1 SMART
EGF 251 280 4.89e0 SMART
EGF 283 311 3.23e0 SMART
EGF_like 314 342 2.98e1 SMART
EGF 345 373 1.87e1 SMART
EGF 376 404 3.97e0 SMART
EGF 407 435 8.52e0 SMART
EGF 438 466 3.01e0 SMART
EGF 469 497 3.46e0 SMART
EGF 500 528 3.71e0 SMART
EGF 531 559 4.32e-1 SMART
EGF 562 590 1.84e1 SMART
EGF 593 621 3.82e-2 SMART
FN3 623 701 8.9e-8 SMART
FN3 712 794 1.53e-6 SMART
FN3 803 884 7.23e-8 SMART
FN3 893 974 1.71e-9 SMART
FN3 985 1062 2.56e-8 SMART
FN3 1074 1152 8.58e-1 SMART
FN3 1165 1245 2.72e-3 SMART
FN3 1256 1334 5.36e-2 SMART
FN3 1347 1427 4.93e0 SMART
FN3 1438 1517 3.4e-4 SMART
FN3 1528 1606 1.55e-7 SMART
FN3 1617 1694 1.53e-6 SMART
FN3 1705 1782 7.75e-8 SMART
FBG 1797 2007 4.08e-124 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135042
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141428
Meta Mutation Damage Score 0.9711 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 95.8%
  • 20x: 90.4%
Validation Efficiency 97% (89/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an extracellular matrix protein with a spatially and temporally restricted tissue distribution. This protein is homohexameric with disulfide-linked subunits, and contains multiple EGF-like and fibronectin type-III domains. It is implicated in guidance of migrating neurons as well as axons during development, synaptic plasticity, and neuronal regeneration. [provided by RefSeq, Jul 2011]
PHENOTYPE: Mice homozygous for several different targeted mutations show variable behavioral and nervous system phenotypes such as abnormal circadian rhythm, anxiety behavior, novelty-induced activity, swimming, impaired synaptic plasticity, long term potentiation and serotonin and dopamine neurotransmission. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810013L24Rik T A 16: 8,843,209 D183E probably damaging Het
4932438A13Rik T A 3: 37,040,506 probably benign Het
4932438A13Rik T C 3: 37,041,390 M1016T probably damaging Het
9330182L06Rik A G 5: 9,428,488 T451A probably damaging Het
Aamp A G 1: 74,282,539 S76P probably damaging Het
Acot8 A G 2: 164,799,690 probably benign Het
Angptl7 A G 4: 148,498,011 F143L probably benign Het
Atxn7l1 A G 12: 33,358,687 T283A probably benign Het
Brd3 G T 2: 27,450,577 probably benign Het
C130026L21Rik T A 5: 111,581,836 noncoding transcript Het
Cbr4 T G 8: 61,495,204 probably null Het
Ccl19 A G 4: 42,756,268 probably null Het
Ccl2 G T 11: 82,036,507 C34F probably damaging Het
Dnah12 A T 14: 26,735,697 T873S probably benign Het
Dnah2 T C 11: 69,448,166 N3118S probably damaging Het
Epb41l1 C A 2: 156,524,939 P564Q possibly damaging Het
Extl3 A T 14: 65,076,032 M567K probably benign Het
Fam160b1 T C 19: 57,386,305 I704T possibly damaging Het
Fam208b A T 13: 3,574,000 H1983Q probably benign Het
Foxf2 T C 13: 31,627,175 S366P probably benign Het
Gamt T A 10: 80,258,954 T186S probably benign Het
Gcn1l1 T A 5: 115,606,671 M1642K probably damaging Het
Gm21738 T A 14: 19,415,957 Y194F probably benign Het
Golga1 A T 2: 39,047,735 M115K probably damaging Het
Herc3 A G 6: 58,894,539 probably null Het
Hes2 C A 4: 152,159,874 L39I possibly damaging Het
Hopx C A 5: 77,095,052 probably benign Het
Idi1 C T 13: 8,888,042 P175S probably damaging Het
Ifit1bl1 A T 19: 34,594,081 C325* probably null Het
Ighv7-3 T C 12: 114,153,333 I70V probably benign Het
Kcnq3 T C 15: 66,285,897 T110A probably benign Het
Kif5a T C 10: 127,239,839 D451G possibly damaging Het
Lama3 A G 18: 12,582,611 E1708G probably benign Het
Lrriq4 T A 3: 30,650,937 D371E probably damaging Het
Lyst T A 13: 13,636,064 V773E probably damaging Het
Map4 T A 9: 110,079,814 L23* probably null Het
Mapkbp1 G T 2: 120,015,501 probably benign Het
Mrpl30 A T 1: 37,897,710 D52V possibly damaging Het
Olfr1122 A T 2: 87,388,658 T318S probably benign Het
Olfr71 A T 4: 43,706,259 L103Q probably damaging Het
Pard3b T A 1: 62,161,161 H286Q probably benign Het
Parp4 A G 14: 56,635,731 K1144R possibly damaging Het
Pdcd11 C A 19: 47,107,115 S625R probably benign Het
Pkhd1l1 T C 15: 44,457,616 S22P probably benign Het
Prss32 A T 17: 23,859,247 E302D possibly damaging Het
Prss45 A G 9: 110,840,470 K205E probably damaging Het
Puf60 T A 15: 76,070,474 I500F probably damaging Het
Ryr3 A T 2: 112,640,171 I4623N probably damaging Het
Sh3bp5l T A 11: 58,338,124 probably benign Het
Slc3a1 T G 17: 85,032,845 Y232D probably damaging Het
Slc8a3 A G 12: 81,214,132 Y608H probably damaging Het
Socs7 G T 11: 97,378,643 R429L probably benign Het
Sorcs3 C A 19: 48,759,951 N786K possibly damaging Het
Sp4 A T 12: 118,254,472 M680K probably benign Het
Tas2r131 T C 6: 132,957,577 T90A probably damaging Het
Tbx21 T C 11: 97,114,710 H143R probably benign Het
Tg T A 15: 66,827,382 C833* probably null Het
Tmem245 A G 4: 56,925,057 S355P probably benign Het
Tmem86b G A 7: 4,628,466 P191S possibly damaging Het
Tnn T A 1: 160,140,738 E361D probably benign Het
Tpp2 T C 1: 44,001,473 V298A possibly damaging Het
Trav7-6 A G 14: 53,717,079 N22S probably damaging Het
Trim75 T C 8: 64,982,439 probably null Het
Trrap T A 5: 144,826,717 I2492N probably damaging Het
Ufl1 G T 4: 25,254,773 A561E probably benign Het
Uqcc1 A G 2: 155,910,421 V86A probably damaging Het
Vmn1r184 A G 7: 26,267,368 I180V possibly damaging Het
Vmn1r185 A G 7: 26,611,495 F195S possibly damaging Het
Vmn2r4 A C 3: 64,398,598 probably null Het
Vmn2r87 T C 10: 130,472,429 T647A probably damaging Het
Vps13d A T 4: 145,086,766 H198Q probably damaging Het
Wdfy4 T C 14: 33,152,670 T154A possibly damaging Het
Xirp2 A G 2: 67,517,134 M3240V probably benign Het
Zfp101 T C 17: 33,381,898 R295G possibly damaging Het
Zfp619 G A 7: 39,535,514 V323I probably benign Het
Zfy1 A T Y: 726,004 I587N possibly damaging Het
Zswim6 C T 13: 107,726,575 noncoding transcript Het
Other mutations in Tnc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Tnc APN 4 64016824 splice site probably benign
IGL00531:Tnc APN 4 63971153 splice site probably benign
IGL00674:Tnc APN 4 63965607 missense probably damaging 1.00
IGL01015:Tnc APN 4 64017334 missense probably benign 0.19
IGL01090:Tnc APN 4 64000080 missense probably damaging 1.00
IGL01310:Tnc APN 4 64013077 missense probably benign 0.03
IGL01331:Tnc APN 4 63982875 missense probably damaging 0.99
IGL01393:Tnc APN 4 64014054 splice site probably benign
IGL01411:Tnc APN 4 64000722 missense probably damaging 0.96
IGL01472:Tnc APN 4 64006419 missense probably benign 0.00
IGL01552:Tnc APN 4 63970408 missense probably damaging 1.00
IGL01661:Tnc APN 4 63970307 splice site probably benign
IGL01669:Tnc APN 4 64000701 missense probably damaging 1.00
IGL01912:Tnc APN 4 64008740 missense probably damaging 1.00
IGL02028:Tnc APN 4 63966672 splice site probably benign
IGL02100:Tnc APN 4 64000161 missense possibly damaging 0.84
IGL02549:Tnc APN 4 64015072 missense probably damaging 1.00
IGL02642:Tnc APN 4 63965579 splice site probably benign
IGL02712:Tnc APN 4 63975256 missense probably damaging 1.00
IGL02876:Tnc APN 4 64015101 missense possibly damaging 0.56
IGL02886:Tnc APN 4 64000107 missense probably damaging 0.96
IGL02972:Tnc APN 4 63976478 missense probably benign 0.11
IGL03073:Tnc APN 4 63971224 missense possibly damaging 0.58
IGL03116:Tnc APN 4 64014033 missense probably damaging 1.00
IGL03181:Tnc APN 4 63967306 missense possibly damaging 0.95
IGL03358:Tnc APN 4 64017615 nonsense probably null
tancredo UTSW 4 63993297 nonsense probably null
P0020:Tnc UTSW 4 64008857 missense possibly damaging 0.63
PIT4377001:Tnc UTSW 4 64017736 missense probably damaging 1.00
PIT4403001:Tnc UTSW 4 63964667 missense probably damaging 1.00
PIT4468001:Tnc UTSW 4 63964667 missense probably damaging 1.00
R0243:Tnc UTSW 4 63970420 missense probably damaging 0.98
R0362:Tnc UTSW 4 64017442 missense probably damaging 1.00
R0410:Tnc UTSW 4 64007694 missense probably benign 0.00
R0420:Tnc UTSW 4 64000159 missense probably benign 0.00
R0540:Tnc UTSW 4 64020455 missense probably damaging 1.00
R0650:Tnc UTSW 4 64008734 missense probably benign 0.00
R1019:Tnc UTSW 4 63962082 missense probably damaging 1.00
R1102:Tnc UTSW 4 64020468 missense probably benign 0.05
R1126:Tnc UTSW 4 64018120 missense probably damaging 0.99
R1141:Tnc UTSW 4 64013994 missense probably damaging 1.00
R1142:Tnc UTSW 4 64013994 missense probably damaging 1.00
R1307:Tnc UTSW 4 64008859 missense probably damaging 0.98
R1322:Tnc UTSW 4 64013994 missense probably damaging 1.00
R1414:Tnc UTSW 4 63965695 splice site probably benign
R1470:Tnc UTSW 4 63966574 missense probably damaging 1.00
R1470:Tnc UTSW 4 63966574 missense probably damaging 1.00
R1499:Tnc UTSW 4 63964754 missense probably benign 0.15
R1506:Tnc UTSW 4 64007684 missense possibly damaging 0.90
R1597:Tnc UTSW 4 64006384 missense probably benign
R1750:Tnc UTSW 4 63972735 missense probably damaging 1.00
R1765:Tnc UTSW 4 64013994 missense probably damaging 1.00
R1783:Tnc UTSW 4 64018096 missense probably damaging 0.98
R1808:Tnc UTSW 4 63999931 missense probably damaging 1.00
R1903:Tnc UTSW 4 64000062 missense probably benign 0.00
R1932:Tnc UTSW 4 63993025 critical splice donor site probably null
R1941:Tnc UTSW 4 64014964 missense probably damaging 1.00
R1983:Tnc UTSW 4 63984630 missense possibly damaging 0.95
R2024:Tnc UTSW 4 63964621 missense probably damaging 1.00
R2075:Tnc UTSW 4 63995666 missense possibly damaging 0.94
R2327:Tnc UTSW 4 63975238 missense possibly damaging 0.78
R2444:Tnc UTSW 4 64014963 missense probably damaging 1.00
R2982:Tnc UTSW 4 64020519 missense possibly damaging 0.81
R3874:Tnc UTSW 4 64008710 missense probably damaging 1.00
R4110:Tnc UTSW 4 64014951 missense probably damaging 1.00
R4360:Tnc UTSW 4 64016924 missense probably benign 0.35
R4371:Tnc UTSW 4 63970351 missense probably damaging 1.00
R4434:Tnc UTSW 4 64007829 missense possibly damaging 0.91
R4438:Tnc UTSW 4 64007829 missense possibly damaging 0.91
R4570:Tnc UTSW 4 63995672 missense probably damaging 0.99
R4595:Tnc UTSW 4 63995745 missense probably damaging 1.00
R4749:Tnc UTSW 4 63995639 missense possibly damaging 0.56
R4756:Tnc UTSW 4 63967343 missense probably damaging 0.99
R4824:Tnc UTSW 4 64017620 nonsense probably null
R4957:Tnc UTSW 4 63976556 missense probably damaging 1.00
R4977:Tnc UTSW 4 64006248 missense possibly damaging 0.82
R5001:Tnc UTSW 4 63984489 missense probably damaging 1.00
R5001:Tnc UTSW 4 64000062 missense probably benign 0.16
R5015:Tnc UTSW 4 64006502 missense probably damaging 1.00
R5066:Tnc UTSW 4 63975229 missense probably damaging 0.96
R5073:Tnc UTSW 4 64020411 missense probably damaging 1.00
R5116:Tnc UTSW 4 63967215 critical splice donor site probably null
R5195:Tnc UTSW 4 63967252 missense probably damaging 1.00
R5200:Tnc UTSW 4 63971278 missense probably damaging 1.00
R5221:Tnc UTSW 4 63993297 nonsense probably null
R5237:Tnc UTSW 4 63962096 missense probably damaging 1.00
R5265:Tnc UTSW 4 63993206 missense probably benign 0.00
R5275:Tnc UTSW 4 63964730 nonsense probably null
R5346:Tnc UTSW 4 64008655 missense probably benign
R5409:Tnc UTSW 4 63966536 missense probably damaging 1.00
R5409:Tnc UTSW 4 64007417 missense probably damaging 1.00
R5469:Tnc UTSW 4 64013925 splice site probably null
R5518:Tnc UTSW 4 64017679 missense probably damaging 1.00
R5560:Tnc UTSW 4 64008709 missense probably damaging 1.00
R5588:Tnc UTSW 4 64006422 missense possibly damaging 0.57
R5686:Tnc UTSW 4 64007730 unclassified probably null
R5686:Tnc UTSW 4 64008795 missense possibly damaging 0.78
R5837:Tnc UTSW 4 64013214 missense probably damaging 1.00
R5976:Tnc UTSW 4 64018166 missense probably benign 0.17
R6156:Tnc UTSW 4 63970352 missense probably damaging 1.00
R6182:Tnc UTSW 4 64008796 missense probably damaging 0.99
R6360:Tnc UTSW 4 64000733 missense probably damaging 1.00
R6416:Tnc UTSW 4 64007816 missense probably benign 0.05
R6778:Tnc UTSW 4 63995598 missense probably benign 0.12
R6798:Tnc UTSW 4 63965604 missense probably benign 0.02
R6799:Tnc UTSW 4 63965604 missense probably benign 0.02
R6943:Tnc UTSW 4 63982745 missense probably damaging 0.97
R7027:Tnc UTSW 4 63984589 missense probably benign 0.02
R7183:Tnc UTSW 4 64013128 missense probably damaging 1.00
R7204:Tnc UTSW 4 63971155 splice site probably null
R7317:Tnc UTSW 4 63972722 missense probably damaging 0.99
R7323:Tnc UTSW 4 63971232 missense probably damaging 0.96
R7327:Tnc UTSW 4 63964762 splice site probably null
R7382:Tnc UTSW 4 64014043 nonsense probably null
R7399:Tnc UTSW 4 64020657 start gained probably benign
R7479:Tnc UTSW 4 64017628 missense possibly damaging 0.95
R7585:Tnc UTSW 4 64020411 missense probably damaging 1.00
R8004:Tnc UTSW 4 63984657 missense probably benign 0.04
S24628:Tnc UTSW 4 64018012 missense probably damaging 1.00
Z1177:Tnc UTSW 4 63960544 critical splice acceptor site probably null
Z1177:Tnc UTSW 4 64007426 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAAATGAGCTCACTGCAGTCCTC -3'
(R):5'- TCTGTGAACCAGGCTGGAAAG -3'

Sequencing Primer
(F):5'- TGCAGTCCTCGCCAGTGAAG -3'
(R):5'- GAAAGGCCCCAACTGCTCTG -3'
Posted On2016-06-15