Incidental Mutation 'R5049:Angptl7'
ID394515
Institutional Source Beutler Lab
Gene Symbol Angptl7
Ensembl Gene ENSMUSG00000028989
Gene Nameangiopoietin-like 7
Synonyms
MMRRC Submission 042639-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5049 (G1)
Quality Score181
Status Validated
Chromosome4
Chromosomal Location148495183-148500460 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 148498011 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 143 (F143L)
Ref Sequence ENSEMBL: ENSMUSP00000030840 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030840] [ENSMUST00000103221]
Predicted Effect probably benign
Transcript: ENSMUST00000030840
AA Change: F143L

PolyPhen 2 Score 0.188 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000030840
Gene: ENSMUSG00000028989
AA Change: F143L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
coiled coil region 36 110 N/A INTRINSIC
FBG 117 333 7.61e-124 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103221
SMART Domains Protein: ENSMUSP00000099510
Gene: ENSMUSG00000028991

DomainStartEndE-ValueType
low complexity region 7 21 N/A INTRINSIC
low complexity region 179 191 N/A INTRINSIC
low complexity region 277 288 N/A INTRINSIC
low complexity region 774 790 N/A INTRINSIC
DUF3385 854 1024 1.51e-93 SMART
low complexity region 1279 1300 N/A INTRINSIC
Pfam:FAT 1513 1908 2.3e-134 PFAM
Rapamycin_bind 2015 2114 7.94e-61 SMART
PI3Kc 2183 2484 8.84e-121 SMART
FATC 2517 2549 2.11e-15 SMART
Meta Mutation Damage Score 0.1253 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 95.8%
  • 20x: 90.4%
Validation Efficiency 97% (89/92)
MGI Phenotype NO_PHENOTYPE,Mice homozygous for a null allele exhibit embryonic lethality by E12.5 due to abnormal embryogenesis. Mice homozygous for an ENU mutation exhibit embryonic lethality by E12.5 with abnormal embryogenesis and brain development. Mice homozygous for a gene trap allele exhibit abnormal embryogenesis.
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810013L24Rik T A 16: 8,843,209 D183E probably damaging Het
4932438A13Rik T A 3: 37,040,506 probably benign Het
4932438A13Rik T C 3: 37,041,390 M1016T probably damaging Het
9330182L06Rik A G 5: 9,428,488 T451A probably damaging Het
Aamp A G 1: 74,282,539 S76P probably damaging Het
Acot8 A G 2: 164,799,690 probably benign Het
Atxn7l1 A G 12: 33,358,687 T283A probably benign Het
Brd3 G T 2: 27,450,577 probably benign Het
C130026L21Rik T A 5: 111,581,836 noncoding transcript Het
Cbr4 T G 8: 61,495,204 probably null Het
Ccl19 A G 4: 42,756,268 probably null Het
Ccl2 G T 11: 82,036,507 C34F probably damaging Het
Dnah12 A T 14: 26,735,697 T873S probably benign Het
Dnah2 T C 11: 69,448,166 N3118S probably damaging Het
Epb41l1 C A 2: 156,524,939 P564Q possibly damaging Het
Extl3 A T 14: 65,076,032 M567K probably benign Het
Fam160b1 T C 19: 57,386,305 I704T possibly damaging Het
Fam208b A T 13: 3,574,000 H1983Q probably benign Het
Foxf2 T C 13: 31,627,175 S366P probably benign Het
Gamt T A 10: 80,258,954 T186S probably benign Het
Gcn1l1 T A 5: 115,606,671 M1642K probably damaging Het
Gm21738 T A 14: 19,415,957 Y194F probably benign Het
Golga1 A T 2: 39,047,735 M115K probably damaging Het
Herc3 A G 6: 58,894,539 probably null Het
Hes2 C A 4: 152,159,874 L39I possibly damaging Het
Hopx C A 5: 77,095,052 probably benign Het
Idi1 C T 13: 8,888,042 P175S probably damaging Het
Ifit1bl1 A T 19: 34,594,081 C325* probably null Het
Ighv7-3 T C 12: 114,153,333 I70V probably benign Het
Kcnq3 T C 15: 66,285,897 T110A probably benign Het
Kif5a T C 10: 127,239,839 D451G possibly damaging Het
Lama3 A G 18: 12,582,611 E1708G probably benign Het
Lrriq4 T A 3: 30,650,937 D371E probably damaging Het
Lyst T A 13: 13,636,064 V773E probably damaging Het
Map4 T A 9: 110,079,814 L23* probably null Het
Mapkbp1 G T 2: 120,015,501 probably benign Het
Mrpl30 A T 1: 37,897,710 D52V possibly damaging Het
Olfr1122 A T 2: 87,388,658 T318S probably benign Het
Olfr71 A T 4: 43,706,259 L103Q probably damaging Het
Pard3b T A 1: 62,161,161 H286Q probably benign Het
Parp4 A G 14: 56,635,731 K1144R possibly damaging Het
Pdcd11 C A 19: 47,107,115 S625R probably benign Het
Pkhd1l1 T C 15: 44,457,616 S22P probably benign Het
Prss32 A T 17: 23,859,247 E302D possibly damaging Het
Prss45 A G 9: 110,840,470 K205E probably damaging Het
Puf60 T A 15: 76,070,474 I500F probably damaging Het
Ryr3 A T 2: 112,640,171 I4623N probably damaging Het
Sh3bp5l T A 11: 58,338,124 probably benign Het
Slc3a1 T G 17: 85,032,845 Y232D probably damaging Het
Slc8a3 A G 12: 81,214,132 Y608H probably damaging Het
Socs7 G T 11: 97,378,643 R429L probably benign Het
Sorcs3 C A 19: 48,759,951 N786K possibly damaging Het
Sp4 A T 12: 118,254,472 M680K probably benign Het
Tas2r131 T C 6: 132,957,577 T90A probably damaging Het
Tbx21 T C 11: 97,114,710 H143R probably benign Het
Tg T A 15: 66,827,382 C833* probably null Het
Tmem245 A G 4: 56,925,057 S355P probably benign Het
Tmem86b G A 7: 4,628,466 P191S possibly damaging Het
Tnc A G 4: 64,017,986 C238R probably damaging Het
Tnn T A 1: 160,140,738 E361D probably benign Het
Tpp2 T C 1: 44,001,473 V298A possibly damaging Het
Trav7-6 A G 14: 53,717,079 N22S probably damaging Het
Trim75 T C 8: 64,982,439 probably null Het
Trrap T A 5: 144,826,717 I2492N probably damaging Het
Ufl1 G T 4: 25,254,773 A561E probably benign Het
Uqcc1 A G 2: 155,910,421 V86A probably damaging Het
Vmn1r184 A G 7: 26,267,368 I180V possibly damaging Het
Vmn1r185 A G 7: 26,611,495 F195S possibly damaging Het
Vmn2r4 A C 3: 64,398,598 probably null Het
Vmn2r87 T C 10: 130,472,429 T647A probably damaging Het
Vps13d A T 4: 145,086,766 H198Q probably damaging Het
Wdfy4 T C 14: 33,152,670 T154A possibly damaging Het
Xirp2 A G 2: 67,517,134 M3240V probably benign Het
Zfp101 T C 17: 33,381,898 R295G possibly damaging Het
Zfp619 G A 7: 39,535,514 V323I probably benign Het
Zfy1 A T Y: 726,004 I587N possibly damaging Het
Zswim6 C T 13: 107,726,575 noncoding transcript Het
Other mutations in Angptl7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02367:Angptl7 APN 4 148500144 missense possibly damaging 0.78
IGL02888:Angptl7 APN 4 148496331 intron probably benign
R1725:Angptl7 UTSW 4 148500012 missense probably damaging 0.96
R1772:Angptl7 UTSW 4 148497426 missense probably damaging 1.00
R1812:Angptl7 UTSW 4 148498083 missense probably damaging 0.96
R2853:Angptl7 UTSW 4 148500279 missense probably benign
R2973:Angptl7 UTSW 4 148500214 nonsense probably null
R4944:Angptl7 UTSW 4 148500077 missense probably damaging 1.00
R5154:Angptl7 UTSW 4 148497425 missense probably damaging 1.00
R5725:Angptl7 UTSW 4 148496508 missense possibly damaging 0.95
R6919:Angptl7 UTSW 4 148500031 missense probably benign 0.09
R6977:Angptl7 UTSW 4 148497393 missense probably damaging 1.00
R7682:Angptl7 UTSW 4 148498082 missense probably damaging 0.96
R7909:Angptl7 UTSW 4 148496210 missense probably benign
R7990:Angptl7 UTSW 4 148496210 missense probably benign
Predicted Primers PCR Primer
(F):5'- GACAGCTGATTCTGCAGACAG -3'
(R):5'- CACGCTGAGGTACAAATCAAG -3'

Sequencing Primer
(F):5'- CTGATTCTGCAGACAGTAGCG -3'
(R):5'- CACGCTGAGGTACAAATCAAGTCTTG -3'
Posted On2016-06-15