Incidental Mutation 'R5049:Trrap'
ID394520
Institutional Source Beutler Lab
Gene Symbol Trrap
Ensembl Gene ENSMUSG00000045482
Gene Nametransformation/transcription domain-associated protein
Synonymstransactivation/transformation-domain associated protein
MMRRC Submission 042639-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5049 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location144767732-144859778 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 144826717 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 2492 (I2492N)
Ref Sequence ENSEMBL: ENSMUSP00000148419 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038980] [ENSMUST00000094120] [ENSMUST00000100467] [ENSMUST00000213013]
Predicted Effect probably damaging
Transcript: ENSMUST00000038980
AA Change: I2473N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042544
Gene: ENSMUSG00000045482
AA Change: I2473N

DomainStartEndE-ValueType
low complexity region 482 527 N/A INTRINSIC
low complexity region 529 540 N/A INTRINSIC
Blast:PI3Kc 765 864 1e-13 BLAST
SCOP:d1gw5a_ 1184 1664 2e-6 SMART
low complexity region 1832 1843 N/A INTRINSIC
low complexity region 1866 1881 N/A INTRINSIC
low complexity region 2289 2303 N/A INTRINSIC
Pfam:FAT 2830 3174 4.7e-69 PFAM
low complexity region 3363 3376 N/A INTRINSIC
low complexity region 3407 3418 N/A INTRINSIC
PI3Kc 3509 3798 5.11e-8 SMART
FATC 3797 3829 1.89e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000094120
AA Change: I2491N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000091668
Gene: ENSMUSG00000045482
AA Change: I2491N

DomainStartEndE-ValueType
low complexity region 482 527 N/A INTRINSIC
low complexity region 529 540 N/A INTRINSIC
Blast:PI3Kc 765 864 1e-13 BLAST
SCOP:d1gw5a_ 1184 1682 2e-6 SMART
low complexity region 1850 1861 N/A INTRINSIC
low complexity region 1884 1899 N/A INTRINSIC
low complexity region 2307 2321 N/A INTRINSIC
Pfam:FAT 2848 3203 1.1e-68 PFAM
low complexity region 3392 3405 N/A INTRINSIC
low complexity region 3436 3447 N/A INTRINSIC
PI3Kc 3538 3827 5.11e-8 SMART
FATC 3826 3858 1.89e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000100467
AA Change: I2473N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098035
Gene: ENSMUSG00000045482
AA Change: I2473N

DomainStartEndE-ValueType
low complexity region 482 527 N/A INTRINSIC
low complexity region 529 540 N/A INTRINSIC
Blast:PI3Kc 765 864 1e-13 BLAST
SCOP:d1gw5a_ 1184 1664 2e-6 SMART
low complexity region 1832 1843 N/A INTRINSIC
low complexity region 1866 1881 N/A INTRINSIC
low complexity region 2289 2303 N/A INTRINSIC
Pfam:FAT 2830 3174 4.7e-69 PFAM
low complexity region 3381 3394 N/A INTRINSIC
low complexity region 3425 3436 N/A INTRINSIC
PI3Kc 3527 3816 5.11e-8 SMART
FATC 3815 3847 1.89e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132347
Predicted Effect unknown
Transcript: ENSMUST00000132925
AA Change: I2212N
SMART Domains Protein: ENSMUSP00000122021
Gene: ENSMUSG00000045482
AA Change: I2212N

DomainStartEndE-ValueType
low complexity region 197 242 N/A INTRINSIC
low complexity region 244 255 N/A INTRINSIC
SCOP:d1gw5a_ 474 1003 9e-7 SMART
Blast:PI3Kc 480 579 1e-13 BLAST
low complexity region 1083 1092 N/A INTRINSIC
low complexity region 1572 1583 N/A INTRINSIC
low complexity region 1606 1621 N/A INTRINSIC
low complexity region 2029 2043 N/A INTRINSIC
Pfam:FAT 2570 2914 1.5e-69 PFAM
low complexity region 3121 3134 N/A INTRINSIC
low complexity region 3165 3176 N/A INTRINSIC
PI3Kc 3267 3556 5.11e-8 SMART
FATC 3555 3587 1.89e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143357
Predicted Effect probably damaging
Transcript: ENSMUST00000213013
AA Change: I2492N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.7937 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 95.8%
  • 20x: 90.4%
Validation Efficiency 97% (89/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large multidomain protein of the phosphoinositide 3-kinase-related kinases (PIKK) family. The encoded protein is a common component of many histone acetyltransferase (HAT) complexes and plays a role in transcription and DNA repair by recruiting HAT complexes to chromatin. Deregulation of this gene may play a role in several types of cancer including glioblastoma multiforme. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous embryos die prior to E3.5 and exhibit embryonic and extraembryonic tissue disorganization. Mitotic abnormalities were also noted in homozygous cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810013L24Rik T A 16: 8,843,209 D183E probably damaging Het
4932438A13Rik T A 3: 37,040,506 probably benign Het
4932438A13Rik T C 3: 37,041,390 M1016T probably damaging Het
9330182L06Rik A G 5: 9,428,488 T451A probably damaging Het
Aamp A G 1: 74,282,539 S76P probably damaging Het
Acot8 A G 2: 164,799,690 probably benign Het
Angptl7 A G 4: 148,498,011 F143L probably benign Het
Atxn7l1 A G 12: 33,358,687 T283A probably benign Het
Brd3 G T 2: 27,450,577 probably benign Het
C130026L21Rik T A 5: 111,581,836 noncoding transcript Het
Cbr4 T G 8: 61,495,204 probably null Het
Ccl19 A G 4: 42,756,268 probably null Het
Ccl2 G T 11: 82,036,507 C34F probably damaging Het
Dnah12 A T 14: 26,735,697 T873S probably benign Het
Dnah2 T C 11: 69,448,166 N3118S probably damaging Het
Epb41l1 C A 2: 156,524,939 P564Q possibly damaging Het
Extl3 A T 14: 65,076,032 M567K probably benign Het
Fam160b1 T C 19: 57,386,305 I704T possibly damaging Het
Fam208b A T 13: 3,574,000 H1983Q probably benign Het
Foxf2 T C 13: 31,627,175 S366P probably benign Het
Gamt T A 10: 80,258,954 T186S probably benign Het
Gcn1l1 T A 5: 115,606,671 M1642K probably damaging Het
Gm21738 T A 14: 19,415,957 Y194F probably benign Het
Golga1 A T 2: 39,047,735 M115K probably damaging Het
Herc3 A G 6: 58,894,539 probably null Het
Hes2 C A 4: 152,159,874 L39I possibly damaging Het
Hopx C A 5: 77,095,052 probably benign Het
Idi1 C T 13: 8,888,042 P175S probably damaging Het
Ifit1bl1 A T 19: 34,594,081 C325* probably null Het
Ighv7-3 T C 12: 114,153,333 I70V probably benign Het
Kcnq3 T C 15: 66,285,897 T110A probably benign Het
Kif5a T C 10: 127,239,839 D451G possibly damaging Het
Lama3 A G 18: 12,582,611 E1708G probably benign Het
Lrriq4 T A 3: 30,650,937 D371E probably damaging Het
Lyst T A 13: 13,636,064 V773E probably damaging Het
Map4 T A 9: 110,079,814 L23* probably null Het
Mapkbp1 G T 2: 120,015,501 probably benign Het
Mrpl30 A T 1: 37,897,710 D52V possibly damaging Het
Olfr1122 A T 2: 87,388,658 T318S probably benign Het
Olfr71 A T 4: 43,706,259 L103Q probably damaging Het
Pard3b T A 1: 62,161,161 H286Q probably benign Het
Parp4 A G 14: 56,635,731 K1144R possibly damaging Het
Pdcd11 C A 19: 47,107,115 S625R probably benign Het
Pkhd1l1 T C 15: 44,457,616 S22P probably benign Het
Prss32 A T 17: 23,859,247 E302D possibly damaging Het
Prss45 A G 9: 110,840,470 K205E probably damaging Het
Puf60 T A 15: 76,070,474 I500F probably damaging Het
Ryr3 A T 2: 112,640,171 I4623N probably damaging Het
Sh3bp5l T A 11: 58,338,124 probably benign Het
Slc3a1 T G 17: 85,032,845 Y232D probably damaging Het
Slc8a3 A G 12: 81,214,132 Y608H probably damaging Het
Socs7 G T 11: 97,378,643 R429L probably benign Het
Sorcs3 C A 19: 48,759,951 N786K possibly damaging Het
Sp4 A T 12: 118,254,472 M680K probably benign Het
Tas2r131 T C 6: 132,957,577 T90A probably damaging Het
Tbx21 T C 11: 97,114,710 H143R probably benign Het
Tg T A 15: 66,827,382 C833* probably null Het
Tmem245 A G 4: 56,925,057 S355P probably benign Het
Tmem86b G A 7: 4,628,466 P191S possibly damaging Het
Tnc A G 4: 64,017,986 C238R probably damaging Het
Tnn T A 1: 160,140,738 E361D probably benign Het
Tpp2 T C 1: 44,001,473 V298A possibly damaging Het
Trav7-6 A G 14: 53,717,079 N22S probably damaging Het
Trim75 T C 8: 64,982,439 probably null Het
Ufl1 G T 4: 25,254,773 A561E probably benign Het
Uqcc1 A G 2: 155,910,421 V86A probably damaging Het
Vmn1r184 A G 7: 26,267,368 I180V possibly damaging Het
Vmn1r185 A G 7: 26,611,495 F195S possibly damaging Het
Vmn2r4 A C 3: 64,398,598 probably null Het
Vmn2r87 T C 10: 130,472,429 T647A probably damaging Het
Vps13d A T 4: 145,086,766 H198Q probably damaging Het
Wdfy4 T C 14: 33,152,670 T154A possibly damaging Het
Xirp2 A G 2: 67,517,134 M3240V probably benign Het
Zfp101 T C 17: 33,381,898 R295G possibly damaging Het
Zfp619 G A 7: 39,535,514 V323I probably benign Het
Zfy1 A T Y: 726,004 I587N possibly damaging Het
Zswim6 C T 13: 107,726,575 noncoding transcript Het
Other mutations in Trrap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Trrap APN 5 144779974 splice site probably benign
IGL00470:Trrap APN 5 144818038 missense probably damaging 1.00
IGL00490:Trrap APN 5 144825225 missense probably benign 0.40
IGL01072:Trrap APN 5 144784255 splice site probably benign
IGL01087:Trrap APN 5 144846539 missense probably damaging 0.99
IGL01300:Trrap APN 5 144804818 missense probably damaging 1.00
IGL01350:Trrap APN 5 144830969 missense possibly damaging 0.92
IGL01410:Trrap APN 5 144831021 missense probably benign 0.00
IGL01571:Trrap APN 5 144833287 splice site probably benign
IGL01748:Trrap APN 5 144833340 missense probably damaging 1.00
IGL01839:Trrap APN 5 144821875 missense probably damaging 1.00
IGL01976:Trrap APN 5 144856989 missense probably benign 0.00
IGL02075:Trrap APN 5 144828494 missense probably benign 0.00
IGL02127:Trrap APN 5 144816433 missense probably benign 0.22
IGL02131:Trrap APN 5 144840436 missense probably damaging 1.00
IGL02287:Trrap APN 5 144832538 missense probably damaging 1.00
IGL02301:Trrap APN 5 144777917 missense probably benign 0.05
IGL02336:Trrap APN 5 144798390 missense probably benign 0.39
IGL02526:Trrap APN 5 144824550 missense probably benign 0.00
IGL02873:Trrap APN 5 144841079 splice site probably benign
IGL02953:Trrap APN 5 144815964 missense probably damaging 0.99
IGL03404:Trrap APN 5 144833186 missense probably benign 0.00
Buffer UTSW 5 144834204 missense probably benign 0.06
Card-tower UTSW 5 144804766 missense probably damaging 1.00
Glass_house UTSW 5 144845477 missense possibly damaging 0.67
Immovable UTSW 5 144790855 missense possibly damaging 0.66
PIT4243001:Trrap UTSW 5 144796971 missense probably benign 0.00
PIT4466001:Trrap UTSW 5 144828600 missense probably benign 0.02
R0062:Trrap UTSW 5 144782193 splice site probably benign
R0062:Trrap UTSW 5 144782193 splice site probably benign
R0112:Trrap UTSW 5 144822761 nonsense probably null
R0126:Trrap UTSW 5 144805750 nonsense probably null
R0257:Trrap UTSW 5 144804235 missense probably benign 0.31
R0325:Trrap UTSW 5 144816395 missense probably benign 0.05
R0376:Trrap UTSW 5 144816339 missense probably benign 0.03
R0396:Trrap UTSW 5 144814556 missense probably damaging 0.99
R0448:Trrap UTSW 5 144839567 missense possibly damaging 0.66
R0454:Trrap UTSW 5 144846477 missense probably damaging 1.00
R0711:Trrap UTSW 5 144853499 missense probably damaging 1.00
R0827:Trrap UTSW 5 144814830 missense probably benign 0.00
R1005:Trrap UTSW 5 144805727 missense probably damaging 1.00
R1147:Trrap UTSW 5 144804766 missense probably damaging 1.00
R1147:Trrap UTSW 5 144804766 missense probably damaging 1.00
R1179:Trrap UTSW 5 144777939 missense possibly damaging 0.94
R1218:Trrap UTSW 5 144816409 missense probably damaging 1.00
R1264:Trrap UTSW 5 144789599 splice site probably benign
R1374:Trrap UTSW 5 144846618 missense probably damaging 1.00
R1401:Trrap UTSW 5 144857422 missense possibly damaging 0.93
R1480:Trrap UTSW 5 144818313 missense probably benign
R1538:Trrap UTSW 5 144837202 missense possibly damaging 0.65
R1751:Trrap UTSW 5 144814575 critical splice donor site probably null
R1779:Trrap UTSW 5 144828590 missense probably benign 0.01
R1782:Trrap UTSW 5 144822703 missense possibly damaging 0.93
R1792:Trrap UTSW 5 144853586 missense possibly damaging 0.87
R1859:Trrap UTSW 5 144830951 missense probably benign 0.04
R1861:Trrap UTSW 5 144815917 splice site probably null
R1902:Trrap UTSW 5 144816053 missense probably damaging 1.00
R1903:Trrap UTSW 5 144816053 missense probably damaging 1.00
R2021:Trrap UTSW 5 144853488 missense possibly damaging 0.94
R2026:Trrap UTSW 5 144803044 missense possibly damaging 0.86
R2036:Trrap UTSW 5 144828562 missense probably benign 0.08
R2099:Trrap UTSW 5 144782239 missense possibly damaging 0.46
R2108:Trrap UTSW 5 144825874 missense probably benign 0.01
R2113:Trrap UTSW 5 144844211 missense probably damaging 1.00
R2174:Trrap UTSW 5 144821855 missense probably benign 0.40
R2442:Trrap UTSW 5 144817966 missense probably damaging 1.00
R2568:Trrap UTSW 5 144843369 critical splice donor site probably null
R3442:Trrap UTSW 5 144792252 missense probably benign 0.03
R3853:Trrap UTSW 5 144792165 missense probably damaging 1.00
R4401:Trrap UTSW 5 144843318 missense possibly damaging 0.60
R4493:Trrap UTSW 5 144831048 missense probably benign 0.21
R4524:Trrap UTSW 5 144825321 missense probably benign 0.38
R4569:Trrap UTSW 5 144792118 missense probably benign 0.13
R4672:Trrap UTSW 5 144785480 missense probably damaging 0.97
R4732:Trrap UTSW 5 144816570 missense probably damaging 1.00
R4733:Trrap UTSW 5 144816570 missense probably damaging 1.00
R4791:Trrap UTSW 5 144803277 missense probably damaging 1.00
R4795:Trrap UTSW 5 144832488 missense probably benign 0.06
R4827:Trrap UTSW 5 144800948 missense probably benign 0.02
R4839:Trrap UTSW 5 144845592 missense probably damaging 1.00
R4915:Trrap UTSW 5 144805735 missense probably damaging 0.99
R4951:Trrap UTSW 5 144805720 missense possibly damaging 0.65
R4959:Trrap UTSW 5 144856960 missense probably damaging 1.00
R5074:Trrap UTSW 5 144851179 missense probably damaging 1.00
R5236:Trrap UTSW 5 144817786 missense probably benign 0.07
R5281:Trrap UTSW 5 144813503 missense probably benign 0.13
R5322:Trrap UTSW 5 144844224 missense probably damaging 1.00
R5457:Trrap UTSW 5 144849977 missense probably damaging 1.00
R5590:Trrap UTSW 5 144782265 missense probably benign 0.05
R5799:Trrap UTSW 5 144830945 missense probably benign
R5885:Trrap UTSW 5 144794793 missense probably damaging 1.00
R5905:Trrap UTSW 5 144849920 missense possibly damaging 0.95
R5908:Trrap UTSW 5 144786708 missense probably damaging 0.96
R5956:Trrap UTSW 5 144807391 splice site silent
R5992:Trrap UTSW 5 144810184 missense probably benign 0.00
R6017:Trrap UTSW 5 144844241 missense probably damaging 1.00
R6029:Trrap UTSW 5 144817679 missense possibly damaging 0.94
R6029:Trrap UTSW 5 144825914 missense possibly damaging 0.75
R6117:Trrap UTSW 5 144802961 missense possibly damaging 0.78
R6166:Trrap UTSW 5 144781981 missense possibly damaging 0.66
R6234:Trrap UTSW 5 144839713 intron probably null
R6288:Trrap UTSW 5 144811992 missense probably damaging 1.00
R6290:Trrap UTSW 5 144805018 missense probably damaging 1.00
R6316:Trrap UTSW 5 144813526 missense probably benign 0.02
R6398:Trrap UTSW 5 144790870 missense possibly damaging 0.83
R6413:Trrap UTSW 5 144784046 missense possibly damaging 0.83
R6499:Trrap UTSW 5 144857002 missense probably damaging 1.00
R6529:Trrap UTSW 5 144834204 missense probably benign 0.06
R6574:Trrap UTSW 5 144815550 critical splice donor site probably null
R6631:Trrap UTSW 5 144771650 missense possibly damaging 0.94
R6727:Trrap UTSW 5 144856950 missense probably damaging 1.00
R6776:Trrap UTSW 5 144851256 nonsense probably null
R6914:Trrap UTSW 5 144784043 missense possibly damaging 0.83
R6942:Trrap UTSW 5 144784043 missense possibly damaging 0.83
R6945:Trrap UTSW 5 144790855 missense possibly damaging 0.66
R7023:Trrap UTSW 5 144792154 missense possibly damaging 0.64
R7107:Trrap UTSW 5 144797135 missense probably benign 0.05
R7139:Trrap UTSW 5 144803178 missense possibly damaging 0.65
R7148:Trrap UTSW 5 144821803 missense possibly damaging 0.77
R7167:Trrap UTSW 5 144839614 missense probably benign 0.39
R7171:Trrap UTSW 5 144794049 missense probably damaging 1.00
R7205:Trrap UTSW 5 144842707 missense possibly damaging 0.94
R7215:Trrap UTSW 5 144797135 missense probably benign 0.05
R7255:Trrap UTSW 5 144858954 missense probably damaging 1.00
R7261:Trrap UTSW 5 144845477 missense possibly damaging 0.67
R7264:Trrap UTSW 5 144814523 missense probably benign 0.05
R7372:Trrap UTSW 5 144789398 missense probably benign
R7447:Trrap UTSW 5 144839474 missense probably damaging 0.97
R7449:Trrap UTSW 5 144851209 missense probably damaging 1.00
R7655:Trrap UTSW 5 144842612 missense probably damaging 1.00
R7656:Trrap UTSW 5 144842612 missense probably damaging 1.00
R7662:Trrap UTSW 5 144832511 missense probably benign 0.00
R7716:Trrap UTSW 5 144777146 missense possibly damaging 0.73
X0060:Trrap UTSW 5 144843361 missense probably damaging 0.96
Z1088:Trrap UTSW 5 144834197 missense probably benign 0.00
Z1177:Trrap UTSW 5 144810344 missense
Z1177:Trrap UTSW 5 144819708 missense probably damaging 1.00
Z1177:Trrap UTSW 5 144856951 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAAAGCTTGAGCCTGCC -3'
(R):5'- GTTCTACGCCTCCTCGAGTG -3'

Sequencing Primer
(F):5'- AAAGCTTGAGCCTGCCTTTCTC -3'
(R):5'- GAGGTACTGAGTTCAATTCCCAGC -3'
Posted On2016-06-15