Incidental Mutation 'R5049:Herc3'
ID 394521
Institutional Source Beutler Lab
Gene Symbol Herc3
Ensembl Gene ENSMUSG00000029804
Gene Name hect domain and RLD 3
Synonyms 5730409F18Rik
MMRRC Submission 042639-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5049 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 58808450-58897383 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to G at 58871524 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145319 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031823] [ENSMUST00000041401] [ENSMUST00000204629]
AlphaFold A6H6S0
Predicted Effect probably null
Transcript: ENSMUST00000031823
SMART Domains Protein: ENSMUSP00000031823
Gene: ENSMUSG00000029804

DomainStartEndE-ValueType
Pfam:RCC1_2 36 65 3.3e-11 PFAM
Pfam:RCC1 52 99 3.6e-15 PFAM
Pfam:RCC1_2 86 115 1.1e-10 PFAM
Pfam:RCC1 102 152 1.4e-16 PFAM
Pfam:RCC1_2 139 168 2.1e-9 PFAM
Pfam:RCC1 155 205 2.6e-16 PFAM
Pfam:RCC1_2 193 221 1.5e-9 PFAM
Pfam:RCC1 208 257 4.7e-17 PFAM
Pfam:RCC1_2 244 273 8e-9 PFAM
Pfam:RCC1 260 309 2.6e-16 PFAM
Pfam:RCC1_2 296 326 2.3e-7 PFAM
Pfam:RCC1 313 377 3.8e-9 PFAM
HECTc 721 913 2.08e-12 SMART
Predicted Effect probably null
Transcript: ENSMUST00000041401
SMART Domains Protein: ENSMUSP00000040025
Gene: ENSMUSG00000029804

DomainStartEndE-ValueType
Pfam:RCC1_2 36 65 1.7e-11 PFAM
Pfam:RCC1 52 99 1.6e-15 PFAM
Pfam:RCC1_2 86 115 1.1e-10 PFAM
Pfam:RCC1 102 152 7.3e-16 PFAM
Pfam:RCC1_2 139 168 1.3e-9 PFAM
Pfam:RCC1 155 205 1.4e-16 PFAM
Pfam:RCC1_2 193 221 5e-10 PFAM
Pfam:RCC1 208 257 1.4e-16 PFAM
Pfam:RCC1_2 244 273 6.1e-8 PFAM
Pfam:RCC1 260 309 1.7e-14 PFAM
Pfam:RCC1_2 296 326 1.1e-7 PFAM
Pfam:RCC1 313 377 6.6e-11 PFAM
HECTc 721 1050 5.79e-157 SMART
Predicted Effect probably null
Transcript: ENSMUST00000204629
SMART Domains Protein: ENSMUSP00000145319
Gene: ENSMUSG00000029804

DomainStartEndE-ValueType
Pfam:HECT 1 97 1.9e-16 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 95.8%
  • 20x: 90.4%
Validation Efficiency 97% (89/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member the HERC ubiquitin ligase family. The encoded protein is located in the cytosol and binds ubiquitin via a HECT domain. Mutations in this gene have been associated with colorectal and gastric carcinomas. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal hair follicle bulge morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aamp A G 1: 74,321,698 (GRCm39) S76P probably damaging Het
Acot8 A G 2: 164,641,610 (GRCm39) probably benign Het
Angptl7 A G 4: 148,582,468 (GRCm39) F143L probably benign Het
Atxn7l1 A G 12: 33,408,686 (GRCm39) T283A probably benign Het
Bltp1 T A 3: 37,094,655 (GRCm39) probably benign Het
Bltp1 T C 3: 37,095,539 (GRCm39) M1016T probably damaging Het
Brd3 G T 2: 27,340,589 (GRCm39) probably benign Het
C130026L21Rik T A 5: 111,729,702 (GRCm39) noncoding transcript Het
Cbr4 T G 8: 61,948,238 (GRCm39) probably null Het
Ccl19 A G 4: 42,756,268 (GRCm39) probably null Het
Ccl2 G T 11: 81,927,333 (GRCm39) C34F probably damaging Het
Dnah12 A T 14: 26,456,852 (GRCm39) T873S probably benign Het
Dnah2 T C 11: 69,338,992 (GRCm39) N3118S probably damaging Het
Elapor2 A G 5: 9,478,488 (GRCm39) T451A probably damaging Het
Epb41l1 C A 2: 156,366,859 (GRCm39) P564Q possibly damaging Het
Extl3 A T 14: 65,313,481 (GRCm39) M567K probably benign Het
Fhip2a T C 19: 57,374,737 (GRCm39) I704T possibly damaging Het
Foxf2 T C 13: 31,811,158 (GRCm39) S366P probably benign Het
Gamt T A 10: 80,094,788 (GRCm39) T186S probably benign Het
Gcn1 T A 5: 115,744,730 (GRCm39) M1642K probably damaging Het
Gm21738 T A 14: 19,415,957 (GRCm38) Y194F probably benign Het
Golga1 A T 2: 38,937,747 (GRCm39) M115K probably damaging Het
Hapstr1 T A 16: 8,661,073 (GRCm39) D183E probably damaging Het
Hes2 C A 4: 152,244,331 (GRCm39) L39I possibly damaging Het
Hopx C A 5: 77,242,899 (GRCm39) probably benign Het
Idi1 C T 13: 8,938,078 (GRCm39) P175S probably damaging Het
Ifit1bl1 A T 19: 34,571,481 (GRCm39) C325* probably null Het
Ighv7-3 T C 12: 114,116,953 (GRCm39) I70V probably benign Het
Kcnq3 T C 15: 66,157,746 (GRCm39) T110A probably benign Het
Kif5a T C 10: 127,075,708 (GRCm39) D451G possibly damaging Het
Lama3 A G 18: 12,715,668 (GRCm39) E1708G probably benign Het
Lrriq4 T A 3: 30,705,086 (GRCm39) D371E probably damaging Het
Lyst T A 13: 13,810,649 (GRCm39) V773E probably damaging Het
Map4 T A 9: 109,908,882 (GRCm39) L23* probably null Het
Mapkbp1 G T 2: 119,845,982 (GRCm39) probably benign Het
Mrpl30 A T 1: 37,936,791 (GRCm39) D52V possibly damaging Het
Or10ag57 A T 2: 87,219,002 (GRCm39) T318S probably benign Het
Or13j1 A T 4: 43,706,259 (GRCm39) L103Q probably damaging Het
Pard3b T A 1: 62,200,320 (GRCm39) H286Q probably benign Het
Parp4 A G 14: 56,873,188 (GRCm39) K1144R possibly damaging Het
Pdcd11 C A 19: 47,095,554 (GRCm39) S625R probably benign Het
Pkhd1l1 T C 15: 44,321,012 (GRCm39) S22P probably benign Het
Prss32 A T 17: 24,078,221 (GRCm39) E302D possibly damaging Het
Prss45 A G 9: 110,669,538 (GRCm39) K205E probably damaging Het
Puf60 T A 15: 75,942,323 (GRCm39) I500F probably damaging Het
Ryr3 A T 2: 112,470,516 (GRCm39) I4623N probably damaging Het
Sh3bp5l T A 11: 58,228,950 (GRCm39) probably benign Het
Slc3a1 T G 17: 85,340,273 (GRCm39) Y232D probably damaging Het
Slc8a3 A G 12: 81,260,906 (GRCm39) Y608H probably damaging Het
Socs7 G T 11: 97,269,469 (GRCm39) R429L probably benign Het
Sorcs3 C A 19: 48,748,390 (GRCm39) N786K possibly damaging Het
Sp4 A T 12: 118,218,207 (GRCm39) M680K probably benign Het
Tas2r131 T C 6: 132,934,540 (GRCm39) T90A probably damaging Het
Tasor2 A T 13: 3,624,000 (GRCm39) H1983Q probably benign Het
Tbx21 T C 11: 97,005,536 (GRCm39) H143R probably benign Het
Tg T A 15: 66,699,231 (GRCm39) C833* probably null Het
Tmem245 A G 4: 56,925,057 (GRCm39) S355P probably benign Het
Tmem86b G A 7: 4,631,465 (GRCm39) P191S possibly damaging Het
Tnc A G 4: 63,936,223 (GRCm39) C238R probably damaging Het
Tnn T A 1: 159,968,308 (GRCm39) E361D probably benign Het
Tpp2 T C 1: 44,040,633 (GRCm39) V298A possibly damaging Het
Trav7-6 A G 14: 53,954,536 (GRCm39) N22S probably damaging Het
Trim75 T C 8: 65,435,091 (GRCm39) probably null Het
Trrap T A 5: 144,763,527 (GRCm39) I2492N probably damaging Het
Ufl1 G T 4: 25,254,773 (GRCm39) A561E probably benign Het
Uqcc1 A G 2: 155,752,341 (GRCm39) V86A probably damaging Het
Vmn1r184 A G 7: 25,966,793 (GRCm39) I180V possibly damaging Het
Vmn1r185 A G 7: 26,310,920 (GRCm39) F195S possibly damaging Het
Vmn2r4 A C 3: 64,306,019 (GRCm39) probably null Het
Vmn2r87 T C 10: 130,308,298 (GRCm39) T647A probably damaging Het
Vps13d A T 4: 144,813,336 (GRCm39) H198Q probably damaging Het
Wdfy4 T C 14: 32,874,627 (GRCm39) T154A possibly damaging Het
Xirp2 A G 2: 67,347,478 (GRCm39) M3240V probably benign Het
Zfp101 T C 17: 33,600,872 (GRCm39) R295G possibly damaging Het
Zfp619 G A 7: 39,184,938 (GRCm39) V323I probably benign Het
Zfy1 A T Y: 726,004 (GRCm39) I587N possibly damaging Het
Zswim6 C T 13: 107,863,110 (GRCm39) noncoding transcript Het
Other mutations in Herc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Herc3 APN 6 58,851,248 (GRCm39) missense probably damaging 1.00
IGL00423:Herc3 APN 6 58,845,700 (GRCm39) missense probably damaging 0.99
IGL00468:Herc3 APN 6 58,895,751 (GRCm39) missense probably benign 0.04
IGL01153:Herc3 APN 6 58,837,321 (GRCm39) missense probably benign 0.21
IGL01468:Herc3 APN 6 58,831,880 (GRCm39) missense probably benign 0.00
IGL01696:Herc3 APN 6 58,837,371 (GRCm39) missense possibly damaging 0.58
IGL01975:Herc3 APN 6 58,893,561 (GRCm39) missense possibly damaging 0.91
IGL02797:Herc3 APN 6 58,845,679 (GRCm39) missense probably benign
IGL02953:Herc3 APN 6 58,834,718 (GRCm39) nonsense probably null
aegean UTSW 6 58,832,745 (GRCm39) nonsense probably null
PIT4519001:Herc3 UTSW 6 58,853,796 (GRCm39) missense probably damaging 1.00
R0019:Herc3 UTSW 6 58,862,050 (GRCm39) splice site probably benign
R0019:Herc3 UTSW 6 58,862,050 (GRCm39) splice site probably benign
R0025:Herc3 UTSW 6 58,851,293 (GRCm39) missense probably damaging 1.00
R0025:Herc3 UTSW 6 58,851,293 (GRCm39) missense probably damaging 1.00
R0268:Herc3 UTSW 6 58,845,613 (GRCm39) splice site probably benign
R0334:Herc3 UTSW 6 58,895,802 (GRCm39) missense probably damaging 1.00
R0344:Herc3 UTSW 6 58,845,613 (GRCm39) splice site probably benign
R0853:Herc3 UTSW 6 58,853,549 (GRCm39) missense probably damaging 1.00
R0927:Herc3 UTSW 6 58,845,748 (GRCm39) missense possibly damaging 0.48
R1333:Herc3 UTSW 6 58,864,478 (GRCm39) missense probably damaging 1.00
R1432:Herc3 UTSW 6 58,893,827 (GRCm39) missense possibly damaging 0.49
R1450:Herc3 UTSW 6 58,853,500 (GRCm39) nonsense probably null
R1594:Herc3 UTSW 6 58,864,569 (GRCm39) unclassified probably benign
R1757:Herc3 UTSW 6 58,893,455 (GRCm39) missense probably damaging 1.00
R1765:Herc3 UTSW 6 58,865,645 (GRCm39) missense probably damaging 0.99
R1932:Herc3 UTSW 6 58,853,778 (GRCm39) missense probably damaging 0.99
R1945:Herc3 UTSW 6 58,864,424 (GRCm39) missense probably damaging 0.96
R1988:Herc3 UTSW 6 58,861,960 (GRCm39) critical splice donor site probably null
R2172:Herc3 UTSW 6 58,864,422 (GRCm39) missense probably damaging 1.00
R3080:Herc3 UTSW 6 58,833,631 (GRCm39) splice site probably null
R3545:Herc3 UTSW 6 58,833,670 (GRCm39) missense probably damaging 1.00
R3767:Herc3 UTSW 6 58,853,587 (GRCm39) missense probably benign 0.00
R3767:Herc3 UTSW 6 58,839,973 (GRCm39) missense probably benign
R3805:Herc3 UTSW 6 58,893,835 (GRCm39) missense probably damaging 1.00
R3806:Herc3 UTSW 6 58,893,835 (GRCm39) missense probably damaging 1.00
R4049:Herc3 UTSW 6 58,853,822 (GRCm39) missense probably damaging 0.99
R4250:Herc3 UTSW 6 58,893,501 (GRCm39) missense probably damaging 1.00
R4469:Herc3 UTSW 6 58,853,794 (GRCm39) nonsense probably null
R4534:Herc3 UTSW 6 58,837,332 (GRCm39) missense probably benign
R4573:Herc3 UTSW 6 58,871,098 (GRCm39) missense possibly damaging 0.89
R4887:Herc3 UTSW 6 58,864,484 (GRCm39) missense probably damaging 1.00
R5047:Herc3 UTSW 6 58,832,745 (GRCm39) nonsense probably null
R5062:Herc3 UTSW 6 58,832,745 (GRCm39) nonsense probably null
R5063:Herc3 UTSW 6 58,832,745 (GRCm39) nonsense probably null
R5288:Herc3 UTSW 6 58,851,263 (GRCm39) missense probably damaging 0.99
R5297:Herc3 UTSW 6 58,833,626 (GRCm39) missense probably damaging 1.00
R5386:Herc3 UTSW 6 58,851,263 (GRCm39) missense probably damaging 0.99
R5435:Herc3 UTSW 6 58,832,791 (GRCm39) missense probably damaging 1.00
R5576:Herc3 UTSW 6 58,865,710 (GRCm39) missense probably benign 0.08
R5605:Herc3 UTSW 6 58,834,712 (GRCm39) missense probably damaging 1.00
R5719:Herc3 UTSW 6 58,871,528 (GRCm39) missense possibly damaging 0.67
R5743:Herc3 UTSW 6 58,895,784 (GRCm39) missense probably benign 0.12
R5870:Herc3 UTSW 6 58,893,435 (GRCm39) missense probably benign 0.01
R6460:Herc3 UTSW 6 58,867,108 (GRCm39) missense probably damaging 1.00
R6930:Herc3 UTSW 6 58,893,444 (GRCm39) missense probably damaging 0.98
R7034:Herc3 UTSW 6 58,853,840 (GRCm39) missense probably benign 0.00
R7131:Herc3 UTSW 6 58,864,409 (GRCm39) missense probably damaging 1.00
R7187:Herc3 UTSW 6 58,833,616 (GRCm39) missense probably benign 0.42
R7212:Herc3 UTSW 6 58,895,758 (GRCm39) missense probably damaging 1.00
R7335:Herc3 UTSW 6 58,853,773 (GRCm39) missense possibly damaging 0.95
R7349:Herc3 UTSW 6 58,835,971 (GRCm39) missense probably benign
R7568:Herc3 UTSW 6 58,820,795 (GRCm39) missense probably benign 0.01
R7857:Herc3 UTSW 6 58,820,637 (GRCm39) nonsense probably null
R8321:Herc3 UTSW 6 58,820,754 (GRCm39) missense possibly damaging 0.93
R8672:Herc3 UTSW 6 58,850,786 (GRCm39) missense probably damaging 0.96
R8684:Herc3 UTSW 6 58,864,561 (GRCm39) missense probably damaging 1.00
R8968:Herc3 UTSW 6 58,867,183 (GRCm39) missense probably damaging 1.00
R8994:Herc3 UTSW 6 58,851,328 (GRCm39) missense probably benign 0.11
R9219:Herc3 UTSW 6 58,871,552 (GRCm39) missense probably benign 0.01
R9434:Herc3 UTSW 6 58,853,846 (GRCm39) missense probably benign 0.00
R9562:Herc3 UTSW 6 58,835,999 (GRCm39) missense probably null 0.01
R9565:Herc3 UTSW 6 58,835,999 (GRCm39) missense probably null 0.01
Z1176:Herc3 UTSW 6 58,820,843 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCACTTAGGATAACTGCCAGG -3'
(R):5'- GCCAAAAGGATGCAGACCTG -3'

Sequencing Primer
(F):5'- GGATAACTGCCAGGACATTTGTTC -3'
(R):5'- GCAGACCTGTAGATAAATGAGCTATC -3'
Posted On 2016-06-15