Incidental Mutation 'R5049:Zfp619'
ID394526
Institutional Source Beutler Lab
Gene Symbol Zfp619
Ensembl Gene ENSMUSG00000068959
Gene Namezinc finger protein 619
Synonyms3000002G13Rik
MMRRC Submission 042639-MU
Accession Numbers

Genbank: NM_001004139; MGI: 1917477

Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R5049 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location39517766-39540420 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 39535514 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 323 (V323I)
Ref Sequence ENSEMBL: ENSMUSP00000103650 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108015]
Predicted Effect probably benign
Transcript: ENSMUST00000108015
AA Change: V323I

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000103650
Gene: ENSMUSG00000068959
AA Change: V323I

DomainStartEndE-ValueType
KRAB 4 61 2.19e-20 SMART
ZnF_C2H2 218 240 2.91e-2 SMART
ZnF_C2H2 246 268 5.81e-2 SMART
ZnF_C2H2 274 296 3.16e-3 SMART
ZnF_C2H2 302 324 2.4e-3 SMART
ZnF_C2H2 330 352 2.95e-3 SMART
ZnF_C2H2 358 380 6.32e-3 SMART
ZnF_C2H2 386 408 8.47e-4 SMART
ZnF_C2H2 414 436 5.06e-2 SMART
ZnF_C2H2 442 464 1.58e-3 SMART
ZnF_C2H2 470 492 5.42e-2 SMART
ZnF_C2H2 526 548 2.09e-3 SMART
ZnF_C2H2 554 576 3.39e-3 SMART
ZnF_C2H2 582 604 1.56e-2 SMART
ZnF_C2H2 610 632 2.24e-3 SMART
ZnF_C2H2 638 660 4.72e-2 SMART
ZnF_C2H2 666 688 7.78e-3 SMART
ZnF_C2H2 694 716 5.9e-3 SMART
ZnF_C2H2 722 744 1.12e-3 SMART
ZnF_C2H2 748 770 6.42e-4 SMART
ZnF_C2H2 776 798 1.38e-3 SMART
ZnF_C2H2 804 826 9.44e-2 SMART
ZnF_C2H2 832 854 2.36e-2 SMART
ZnF_C2H2 860 882 8.94e-3 SMART
ZnF_C2H2 888 910 3.58e-2 SMART
ZnF_C2H2 916 938 6.42e-4 SMART
ZnF_C2H2 942 964 4.72e-2 SMART
ZnF_C2H2 970 992 2.3e-5 SMART
ZnF_C2H2 998 1020 8.34e-3 SMART
ZnF_C2H2 1026 1048 8.81e-2 SMART
ZnF_C2H2 1054 1076 1.69e-3 SMART
ZnF_C2H2 1082 1104 6.32e-3 SMART
ZnF_C2H2 1110 1132 1.47e-3 SMART
ZnF_C2H2 1138 1160 7.15e-2 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 95.8%
  • 20x: 90.4%
Validation Efficiency 97% (89/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Zinc finger proteins (ZNFs), such as ZNF208, bind DNA and, through this binding, regulate gene transcription. Most ZNFs contain conserved C2H2 motifs and are classified as Kruppel-type zinc fingers. A conserved protein motif, termed the Kruppel-associated box (KRAB) domain, mediates protein-protein interactions (Eichler et al., 1998 [PubMed 9724325]). See ZNF91 (MIM 603971) for further information on ZNFs.[supplied by OMIM, Aug 2009]
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810013L24Rik T A 16: 8,843,209 D183E probably damaging Het
4932438A13Rik T A 3: 37,040,506 probably benign Het
4932438A13Rik T C 3: 37,041,390 M1016T probably damaging Het
9330182L06Rik A G 5: 9,428,488 T451A probably damaging Het
Aamp A G 1: 74,282,539 S76P probably damaging Het
Acot8 A G 2: 164,799,690 probably benign Het
Angptl7 A G 4: 148,498,011 F143L probably benign Het
Atxn7l1 A G 12: 33,358,687 T283A probably benign Het
Brd3 G T 2: 27,450,577 probably benign Het
C130026L21Rik T A 5: 111,581,836 noncoding transcript Het
Cbr4 T G 8: 61,495,204 probably null Het
Ccl19 A G 4: 42,756,268 probably null Het
Ccl2 G T 11: 82,036,507 C34F probably damaging Het
Dnah12 A T 14: 26,735,697 T873S probably benign Het
Dnah2 T C 11: 69,448,166 N3118S probably damaging Het
Epb41l1 C A 2: 156,524,939 P564Q possibly damaging Het
Extl3 A T 14: 65,076,032 M567K probably benign Het
Fam160b1 T C 19: 57,386,305 I704T possibly damaging Het
Fam208b A T 13: 3,574,000 H1983Q probably benign Het
Foxf2 T C 13: 31,627,175 S366P probably benign Het
Gamt T A 10: 80,258,954 T186S probably benign Het
Gcn1l1 T A 5: 115,606,671 M1642K probably damaging Het
Gm21738 T A 14: 19,415,957 Y194F probably benign Het
Golga1 A T 2: 39,047,735 M115K probably damaging Het
Herc3 A G 6: 58,894,539 probably null Het
Hes2 C A 4: 152,159,874 L39I possibly damaging Het
Hopx C A 5: 77,095,052 probably benign Het
Idi1 C T 13: 8,888,042 P175S probably damaging Het
Ifit1bl1 A T 19: 34,594,081 C325* probably null Het
Ighv7-3 T C 12: 114,153,333 I70V probably benign Het
Kcnq3 T C 15: 66,285,897 T110A probably benign Het
Kif5a T C 10: 127,239,839 D451G possibly damaging Het
Lama3 A G 18: 12,582,611 E1708G probably benign Het
Lrriq4 T A 3: 30,650,937 D371E probably damaging Het
Lyst T A 13: 13,636,064 V773E probably damaging Het
Map4 T A 9: 110,079,814 L23* probably null Het
Mapkbp1 G T 2: 120,015,501 probably benign Het
Mrpl30 A T 1: 37,897,710 D52V possibly damaging Het
Olfr1122 A T 2: 87,388,658 T318S probably benign Het
Olfr71 A T 4: 43,706,259 L103Q probably damaging Het
Pard3b T A 1: 62,161,161 H286Q probably benign Het
Parp4 A G 14: 56,635,731 K1144R possibly damaging Het
Pdcd11 C A 19: 47,107,115 S625R probably benign Het
Pkhd1l1 T C 15: 44,457,616 S22P probably benign Het
Prss32 A T 17: 23,859,247 E302D possibly damaging Het
Prss45 A G 9: 110,840,470 K205E probably damaging Het
Puf60 T A 15: 76,070,474 I500F probably damaging Het
Ryr3 A T 2: 112,640,171 I4623N probably damaging Het
Sh3bp5l T A 11: 58,338,124 probably benign Het
Slc3a1 T G 17: 85,032,845 Y232D probably damaging Het
Slc8a3 A G 12: 81,214,132 Y608H probably damaging Het
Socs7 G T 11: 97,378,643 R429L probably benign Het
Sorcs3 C A 19: 48,759,951 N786K possibly damaging Het
Sp4 A T 12: 118,254,472 M680K probably benign Het
Tas2r131 T C 6: 132,957,577 T90A probably damaging Het
Tbx21 T C 11: 97,114,710 H143R probably benign Het
Tg T A 15: 66,827,382 C833* probably null Het
Tmem245 A G 4: 56,925,057 S355P probably benign Het
Tmem86b G A 7: 4,628,466 P191S possibly damaging Het
Tnc A G 4: 64,017,986 C238R probably damaging Het
Tnn T A 1: 160,140,738 E361D probably benign Het
Tpp2 T C 1: 44,001,473 V298A possibly damaging Het
Trav7-6 A G 14: 53,717,079 N22S probably damaging Het
Trim75 T C 8: 64,982,439 probably null Het
Trrap T A 5: 144,826,717 I2492N probably damaging Het
Ufl1 G T 4: 25,254,773 A561E probably benign Het
Uqcc1 A G 2: 155,910,421 V86A probably damaging Het
Vmn1r184 A G 7: 26,267,368 I180V possibly damaging Het
Vmn1r185 A G 7: 26,611,495 F195S possibly damaging Het
Vmn2r4 A C 3: 64,398,598 probably null Het
Vmn2r87 T C 10: 130,472,429 T647A probably damaging Het
Vps13d A T 4: 145,086,766 H198Q probably damaging Het
Wdfy4 T C 14: 33,152,670 T154A possibly damaging Het
Xirp2 A G 2: 67,517,134 M3240V probably benign Het
Zfp101 T C 17: 33,381,898 R295G possibly damaging Het
Zfy1 A T Y: 726,004 I587N possibly damaging Het
Zswim6 C T 13: 107,726,575 noncoding transcript Het
Other mutations in Zfp619
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02157:Zfp619 APN 7 39534864 missense probably damaging 1.00
IGL02221:Zfp619 APN 7 39536910 missense probably benign 0.00
IGL02625:Zfp619 APN 7 39534185 splice site probably benign
3-1:Zfp619 UTSW 7 39536765 missense probably damaging 1.00
R0035:Zfp619 UTSW 7 39537282 missense probably damaging 1.00
R0035:Zfp619 UTSW 7 39537282 missense probably damaging 1.00
R0113:Zfp619 UTSW 7 39537759 missense probably benign 0.01
R0377:Zfp619 UTSW 7 39536797 nonsense probably null
R0614:Zfp619 UTSW 7 39537675 missense possibly damaging 0.79
R0848:Zfp619 UTSW 7 39536559 missense probably damaging 1.00
R1157:Zfp619 UTSW 7 39536858 missense probably damaging 0.98
R2047:Zfp619 UTSW 7 39537638 missense probably damaging 0.99
R2074:Zfp619 UTSW 7 39534761 missense probably benign 0.00
R2419:Zfp619 UTSW 7 39535883 missense possibly damaging 0.71
R2571:Zfp619 UTSW 7 39537171 missense probably damaging 1.00
R2890:Zfp619 UTSW 7 39534969 missense probably benign 0.00
R3814:Zfp619 UTSW 7 39535399 missense probably benign 0.01
R4003:Zfp619 UTSW 7 39537306 missense possibly damaging 0.91
R4059:Zfp619 UTSW 7 39535399 missense probably benign 0.01
R4503:Zfp619 UTSW 7 39536856 missense probably damaging 1.00
R4664:Zfp619 UTSW 7 39534135 missense probably benign 0.00
R4696:Zfp619 UTSW 7 39536988 missense probably benign 0.00
R4895:Zfp619 UTSW 7 39537972 missense possibly damaging 0.68
R4975:Zfp619 UTSW 7 39537080 missense possibly damaging 0.90
R4977:Zfp619 UTSW 7 39537387 missense probably damaging 1.00
R5240:Zfp619 UTSW 7 39537218 missense possibly damaging 0.68
R5468:Zfp619 UTSW 7 39535728 missense unknown
R5546:Zfp619 UTSW 7 39535153 missense probably benign 0.01
R5572:Zfp619 UTSW 7 39535239 missense probably benign 0.01
R6106:Zfp619 UTSW 7 39535134 missense probably benign 0.01
R6329:Zfp619 UTSW 7 39537545 missense probably damaging 1.00
R6354:Zfp619 UTSW 7 39534819 missense probably benign 0.02
R6395:Zfp619 UTSW 7 39537030 missense possibly damaging 0.91
R6490:Zfp619 UTSW 7 39534162 missense probably benign 0.00
R6560:Zfp619 UTSW 7 39537530 missense probably damaging 1.00
R6713:Zfp619 UTSW 7 39537898 missense probably damaging 0.99
R7011:Zfp619 UTSW 7 39537762 missense probably damaging 1.00
R7022:Zfp619 UTSW 7 39534963 missense probably benign 0.00
R7046:Zfp619 UTSW 7 39537363 missense possibly damaging 0.95
R7206:Zfp619 UTSW 7 39535400 missense probably benign 0.00
R7780:Zfp619 UTSW 7 39535008 missense possibly damaging 0.68
R7787:Zfp619 UTSW 7 39536802 missense possibly damaging 0.91
R8001:Zfp619 UTSW 7 39535221 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- AGATGTCACAGTTCCCTTCAGAGA -3'
(R):5'- GCTGTGCCCTTTGAAAGCCT -3'

Sequencing Primer
(F):5'- CCCTATGAATGTAAACAGTGTGG -3'
(R):5'- ACACTGCTTACACTCGTAGGG -3'
Posted On2016-06-15