Incidental Mutation 'R5049:Puf60'
ID394559
Institutional Source Beutler Lab
Gene Symbol Puf60
Ensembl Gene ENSMUSG00000002524
Gene Namepoly-U binding splicing factor 60
Synonyms
MMRRC Submission 042639-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.947) question?
Stock #R5049 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location76070182-76080924 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 76070474 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 500 (I500F)
Ref Sequence ENSEMBL: ENSMUSP00000002599 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002599] [ENSMUST00000002603] [ENSMUST00000063747] [ENSMUST00000100527] [ENSMUST00000109946] [ENSMUST00000227316] [ENSMUST00000230924]
Predicted Effect probably damaging
Transcript: ENSMUST00000002599
AA Change: I500F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000002599
Gene: ENSMUSG00000002524
AA Change: I500F

DomainStartEndE-ValueType
low complexity region 21 34 N/A INTRINSIC
low complexity region 103 114 N/A INTRINSIC
RRM 118 191 1.21e-22 SMART
RRM 215 288 1.6e-22 SMART
low complexity region 290 338 N/A INTRINSIC
low complexity region 400 420 N/A INTRINSIC
RRM 451 533 7.68e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000002603
SMART Domains Protein: ENSMUSP00000002603
Gene: ENSMUSG00000022568

DomainStartEndE-ValueType
LRR 58 80 1.99e0 SMART
LRR 81 104 2.54e2 SMART
LRR 127 149 3.56e2 SMART
LRR 150 172 2.33e1 SMART
LRR 173 195 2.45e0 SMART
LRR_TYP 196 218 7.78e-3 SMART
LRR 219 241 7.79e0 SMART
LRR 242 265 1.41e0 SMART
LRR 288 310 2.47e2 SMART
LRR_TYP 311 334 2.36e-2 SMART
LRR 335 356 7.8e1 SMART
LRR 357 380 1.22e2 SMART
low complexity region 455 466 N/A INTRINSIC
low complexity region 502 511 N/A INTRINSIC
coiled coil region 653 685 N/A INTRINSIC
PDZ 722 801 2e-23 SMART
low complexity region 822 837 N/A INTRINSIC
PDZ 856 936 1.23e-23 SMART
low complexity region 941 965 N/A INTRINSIC
low complexity region 968 978 N/A INTRINSIC
PDZ 998 1079 6.7e-25 SMART
PDZ 1095 1178 3.88e-21 SMART
low complexity region 1306 1321 N/A INTRINSIC
coiled coil region 1390 1420 N/A INTRINSIC
low complexity region 1452 1464 N/A INTRINSIC
low complexity region 1498 1515 N/A INTRINSIC
low complexity region 1549 1560 N/A INTRINSIC
low complexity region 1648 1665 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000063747
SMART Domains Protein: ENSMUSP00000068056
Gene: ENSMUSG00000022568

DomainStartEndE-ValueType
LRR 58 80 1.99e0 SMART
LRR 81 104 2.54e2 SMART
LRR 127 149 3.56e2 SMART
LRR 150 172 2.33e1 SMART
LRR 173 195 2.45e0 SMART
LRR_TYP 196 218 7.78e-3 SMART
LRR 219 241 7.79e0 SMART
LRR 242 265 1.41e0 SMART
LRR 288 310 2.47e2 SMART
LRR_TYP 311 334 2.36e-2 SMART
LRR 335 356 7.8e1 SMART
LRR 357 380 1.22e2 SMART
low complexity region 455 466 N/A INTRINSIC
low complexity region 502 511 N/A INTRINSIC
coiled coil region 653 685 N/A INTRINSIC
PDZ 722 801 2e-23 SMART
low complexity region 822 837 N/A INTRINSIC
PDZ 856 936 1.23e-23 SMART
low complexity region 941 965 N/A INTRINSIC
low complexity region 968 978 N/A INTRINSIC
PDZ 998 1079 6.7e-25 SMART
PDZ 1095 1178 3.88e-21 SMART
low complexity region 1282 1293 N/A INTRINSIC
coiled coil region 1362 1392 N/A INTRINSIC
low complexity region 1424 1436 N/A INTRINSIC
low complexity region 1470 1487 N/A INTRINSIC
low complexity region 1521 1532 N/A INTRINSIC
low complexity region 1595 1612 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100527
AA Change: I517F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000098096
Gene: ENSMUSG00000002524
AA Change: I517F

DomainStartEndE-ValueType
low complexity region 21 34 N/A INTRINSIC
RRM 135 208 1.21e-22 SMART
RRM 232 305 1.6e-22 SMART
low complexity region 307 355 N/A INTRINSIC
low complexity region 417 437 N/A INTRINSIC
RRM 468 550 7.68e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109946
SMART Domains Protein: ENSMUSP00000105572
Gene: ENSMUSG00000022568

DomainStartEndE-ValueType
LRR 58 80 1.99e0 SMART
LRR 81 104 2.54e2 SMART
LRR 127 149 3.56e2 SMART
LRR 150 172 2.33e1 SMART
LRR 173 195 2.45e0 SMART
LRR_TYP 196 218 7.78e-3 SMART
LRR 219 241 7.79e0 SMART
LRR 242 265 1.41e0 SMART
LRR 288 310 2.47e2 SMART
LRR_TYP 311 334 2.36e-2 SMART
LRR 335 356 7.8e1 SMART
LRR 357 380 1.22e2 SMART
low complexity region 455 466 N/A INTRINSIC
low complexity region 502 511 N/A INTRINSIC
coiled coil region 653 685 N/A INTRINSIC
PDZ 722 801 2e-23 SMART
low complexity region 822 837 N/A INTRINSIC
PDZ 856 936 1.23e-23 SMART
low complexity region 941 965 N/A INTRINSIC
low complexity region 968 978 N/A INTRINSIC
PDZ 998 1079 6.7e-25 SMART
PDZ 1095 1178 3.88e-21 SMART
low complexity region 1282 1293 N/A INTRINSIC
coiled coil region 1362 1392 N/A INTRINSIC
low complexity region 1424 1436 N/A INTRINSIC
low complexity region 1470 1487 N/A INTRINSIC
low complexity region 1521 1532 N/A INTRINSIC
low complexity region 1620 1637 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227251
Predicted Effect probably benign
Transcript: ENSMUST00000227316
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229474
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229496
Predicted Effect probably benign
Transcript: ENSMUST00000230924
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230968
Meta Mutation Damage Score 0.4032 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 95.8%
  • 20x: 90.4%
Validation Efficiency 97% (89/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nucleic acid-binding protein that plays a role in a variety of nuclear processes, including pre-mRNA splicing and transcriptional regulation. The encoded protein forms a complex with the far upstream DNA element (FUSE) and FUSE-binding protein at the myelocytomatosis oncogene (MYC) promoter. This complex represses MYC transcription through the core-TFIIH basal transcription factor. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810013L24Rik T A 16: 8,843,209 D183E probably damaging Het
4932438A13Rik T A 3: 37,040,506 probably benign Het
4932438A13Rik T C 3: 37,041,390 M1016T probably damaging Het
9330182L06Rik A G 5: 9,428,488 T451A probably damaging Het
Aamp A G 1: 74,282,539 S76P probably damaging Het
Acot8 A G 2: 164,799,690 probably benign Het
Angptl7 A G 4: 148,498,011 F143L probably benign Het
Atxn7l1 A G 12: 33,358,687 T283A probably benign Het
Brd3 G T 2: 27,450,577 probably benign Het
C130026L21Rik T A 5: 111,581,836 noncoding transcript Het
Cbr4 T G 8: 61,495,204 probably null Het
Ccl19 A G 4: 42,756,268 probably null Het
Ccl2 G T 11: 82,036,507 C34F probably damaging Het
Dnah12 A T 14: 26,735,697 T873S probably benign Het
Dnah2 T C 11: 69,448,166 N3118S probably damaging Het
Epb41l1 C A 2: 156,524,939 P564Q possibly damaging Het
Extl3 A T 14: 65,076,032 M567K probably benign Het
Fam160b1 T C 19: 57,386,305 I704T possibly damaging Het
Fam208b A T 13: 3,574,000 H1983Q probably benign Het
Foxf2 T C 13: 31,627,175 S366P probably benign Het
Gamt T A 10: 80,258,954 T186S probably benign Het
Gcn1l1 T A 5: 115,606,671 M1642K probably damaging Het
Gm21738 T A 14: 19,415,957 Y194F probably benign Het
Golga1 A T 2: 39,047,735 M115K probably damaging Het
Herc3 A G 6: 58,894,539 probably null Het
Hes2 C A 4: 152,159,874 L39I possibly damaging Het
Hopx C A 5: 77,095,052 probably benign Het
Idi1 C T 13: 8,888,042 P175S probably damaging Het
Ifit1bl1 A T 19: 34,594,081 C325* probably null Het
Ighv7-3 T C 12: 114,153,333 I70V probably benign Het
Kcnq3 T C 15: 66,285,897 T110A probably benign Het
Kif5a T C 10: 127,239,839 D451G possibly damaging Het
Lama3 A G 18: 12,582,611 E1708G probably benign Het
Lrriq4 T A 3: 30,650,937 D371E probably damaging Het
Lyst T A 13: 13,636,064 V773E probably damaging Het
Map4 T A 9: 110,079,814 L23* probably null Het
Mapkbp1 G T 2: 120,015,501 probably benign Het
Mrpl30 A T 1: 37,897,710 D52V possibly damaging Het
Olfr1122 A T 2: 87,388,658 T318S probably benign Het
Olfr71 A T 4: 43,706,259 L103Q probably damaging Het
Pard3b T A 1: 62,161,161 H286Q probably benign Het
Parp4 A G 14: 56,635,731 K1144R possibly damaging Het
Pdcd11 C A 19: 47,107,115 S625R probably benign Het
Pkhd1l1 T C 15: 44,457,616 S22P probably benign Het
Prss32 A T 17: 23,859,247 E302D possibly damaging Het
Prss45 A G 9: 110,840,470 K205E probably damaging Het
Ryr3 A T 2: 112,640,171 I4623N probably damaging Het
Sh3bp5l T A 11: 58,338,124 probably benign Het
Slc3a1 T G 17: 85,032,845 Y232D probably damaging Het
Slc8a3 A G 12: 81,214,132 Y608H probably damaging Het
Socs7 G T 11: 97,378,643 R429L probably benign Het
Sorcs3 C A 19: 48,759,951 N786K possibly damaging Het
Sp4 A T 12: 118,254,472 M680K probably benign Het
Tas2r131 T C 6: 132,957,577 T90A probably damaging Het
Tbx21 T C 11: 97,114,710 H143R probably benign Het
Tg T A 15: 66,827,382 C833* probably null Het
Tmem245 A G 4: 56,925,057 S355P probably benign Het
Tmem86b G A 7: 4,628,466 P191S possibly damaging Het
Tnc A G 4: 64,017,986 C238R probably damaging Het
Tnn T A 1: 160,140,738 E361D probably benign Het
Tpp2 T C 1: 44,001,473 V298A possibly damaging Het
Trav7-6 A G 14: 53,717,079 N22S probably damaging Het
Trim75 T C 8: 64,982,439 probably null Het
Trrap T A 5: 144,826,717 I2492N probably damaging Het
Ufl1 G T 4: 25,254,773 A561E probably benign Het
Uqcc1 A G 2: 155,910,421 V86A probably damaging Het
Vmn1r184 A G 7: 26,267,368 I180V possibly damaging Het
Vmn1r185 A G 7: 26,611,495 F195S possibly damaging Het
Vmn2r4 A C 3: 64,398,598 probably null Het
Vmn2r87 T C 10: 130,472,429 T647A probably damaging Het
Vps13d A T 4: 145,086,766 H198Q probably damaging Het
Wdfy4 T C 14: 33,152,670 T154A possibly damaging Het
Xirp2 A G 2: 67,517,134 M3240V probably benign Het
Zfp101 T C 17: 33,381,898 R295G possibly damaging Het
Zfp619 G A 7: 39,535,514 V323I probably benign Het
Zfy1 A T Y: 726,004 I587N possibly damaging Het
Zswim6 C T 13: 107,726,575 noncoding transcript Het
Other mutations in Puf60
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02406:Puf60 APN 15 76074609 missense probably damaging 0.98
IGL02468:Puf60 APN 15 76075836 splice site probably benign
IGL03252:Puf60 APN 15 76071850 missense probably damaging 1.00
IGL03256:Puf60 APN 15 76070596 missense possibly damaging 0.47
IGL03344:Puf60 APN 15 76070380 missense possibly damaging 0.83
R0194:Puf60 UTSW 15 76070485 missense probably damaging 1.00
R0688:Puf60 UTSW 15 76070774 missense probably damaging 1.00
R1746:Puf60 UTSW 15 76070784 missense probably benign 0.08
R1770:Puf60 UTSW 15 76070874 missense probably benign 0.00
R1782:Puf60 UTSW 15 76071875 missense probably benign 0.32
R1818:Puf60 UTSW 15 76071474 missense possibly damaging 0.91
R2172:Puf60 UTSW 15 76070464 missense probably damaging 1.00
R4726:Puf60 UTSW 15 76072334 unclassified probably null
R6927:Puf60 UTSW 15 76075814 missense probably benign
R7199:Puf60 UTSW 15 76071868 missense probably damaging 0.99
R7240:Puf60 UTSW 15 76072539 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AGGGACACACCACGGTTAAC -3'
(R):5'- AGTCACAGCAGTCAATTGTCTTTC -3'

Sequencing Primer
(F):5'- GGACACACCACGGTTAACACTTTAC -3'
(R):5'- TTTCCTACAGTCTACAGTGATGG -3'
Posted On2016-06-15