Incidental Mutation 'R5049:Zfp101'
ID394563
Institutional Source Beutler Lab
Gene Symbol Zfp101
Ensembl Gene ENSMUSG00000055240
Gene Namezinc finger protein 101
Synonyms
MMRRC Submission 042639-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R5049 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location33360507-33394641 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 33381898 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 295 (R295G)
Ref Sequence ENSEMBL: ENSMUSP00000132508 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167107] [ENSMUST00000174417] [ENSMUST00000174512]
Predicted Effect possibly damaging
Transcript: ENSMUST00000167107
AA Change: R295G

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000132508
Gene: ENSMUSG00000055240
AA Change: R295G

DomainStartEndE-ValueType
KRAB 10 62 9.34e-15 SMART
ZnF_C2H2 219 241 2.57e-3 SMART
ZnF_C2H2 247 269 6.32e-3 SMART
ZnF_C2H2 275 297 3.16e-3 SMART
ZnF_C2H2 302 322 1.65e2 SMART
ZnF_C2H2 330 352 6.75e0 SMART
ZnF_C2H2 358 380 2.75e-3 SMART
ZnF_C2H2 386 408 4.47e-3 SMART
ZnF_C2H2 414 436 2.09e-3 SMART
ZnF_C2H2 442 464 4.79e-3 SMART
ZnF_C2H2 470 492 2.2e-2 SMART
ZnF_C2H2 498 520 4.47e-3 SMART
ZnF_C2H2 526 548 4.72e-2 SMART
ZnF_C2H2 554 576 1.28e-3 SMART
ZnF_C2H2 583 605 5.06e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173151
Predicted Effect probably benign
Transcript: ENSMUST00000174417
SMART Domains Protein: ENSMUSP00000134459
Gene: ENSMUSG00000055240

DomainStartEndE-ValueType
Blast:KRAB 1 38 5e-16 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000174512
SMART Domains Protein: ENSMUSP00000133873
Gene: ENSMUSG00000055240

DomainStartEndE-ValueType
KRAB 10 62 9.34e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183047
Meta Mutation Damage Score 0.3023 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 95.8%
  • 20x: 90.4%
Validation Efficiency 97% (89/92)
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810013L24Rik T A 16: 8,843,209 D183E probably damaging Het
4932438A13Rik T A 3: 37,040,506 probably benign Het
4932438A13Rik T C 3: 37,041,390 M1016T probably damaging Het
9330182L06Rik A G 5: 9,428,488 T451A probably damaging Het
Aamp A G 1: 74,282,539 S76P probably damaging Het
Acot8 A G 2: 164,799,690 probably benign Het
Angptl7 A G 4: 148,498,011 F143L probably benign Het
Atxn7l1 A G 12: 33,358,687 T283A probably benign Het
Brd3 G T 2: 27,450,577 probably benign Het
C130026L21Rik T A 5: 111,581,836 noncoding transcript Het
Cbr4 T G 8: 61,495,204 probably null Het
Ccl19 A G 4: 42,756,268 probably null Het
Ccl2 G T 11: 82,036,507 C34F probably damaging Het
Dnah12 A T 14: 26,735,697 T873S probably benign Het
Dnah2 T C 11: 69,448,166 N3118S probably damaging Het
Epb41l1 C A 2: 156,524,939 P564Q possibly damaging Het
Extl3 A T 14: 65,076,032 M567K probably benign Het
Fam160b1 T C 19: 57,386,305 I704T possibly damaging Het
Fam208b A T 13: 3,574,000 H1983Q probably benign Het
Foxf2 T C 13: 31,627,175 S366P probably benign Het
Gamt T A 10: 80,258,954 T186S probably benign Het
Gcn1l1 T A 5: 115,606,671 M1642K probably damaging Het
Gm21738 T A 14: 19,415,957 Y194F probably benign Het
Golga1 A T 2: 39,047,735 M115K probably damaging Het
Herc3 A G 6: 58,894,539 probably null Het
Hes2 C A 4: 152,159,874 L39I possibly damaging Het
Hopx C A 5: 77,095,052 probably benign Het
Idi1 C T 13: 8,888,042 P175S probably damaging Het
Ifit1bl1 A T 19: 34,594,081 C325* probably null Het
Ighv7-3 T C 12: 114,153,333 I70V probably benign Het
Kcnq3 T C 15: 66,285,897 T110A probably benign Het
Kif5a T C 10: 127,239,839 D451G possibly damaging Het
Lama3 A G 18: 12,582,611 E1708G probably benign Het
Lrriq4 T A 3: 30,650,937 D371E probably damaging Het
Lyst T A 13: 13,636,064 V773E probably damaging Het
Map4 T A 9: 110,079,814 L23* probably null Het
Mapkbp1 G T 2: 120,015,501 probably benign Het
Mrpl30 A T 1: 37,897,710 D52V possibly damaging Het
Olfr1122 A T 2: 87,388,658 T318S probably benign Het
Olfr71 A T 4: 43,706,259 L103Q probably damaging Het
Pard3b T A 1: 62,161,161 H286Q probably benign Het
Parp4 A G 14: 56,635,731 K1144R possibly damaging Het
Pdcd11 C A 19: 47,107,115 S625R probably benign Het
Pkhd1l1 T C 15: 44,457,616 S22P probably benign Het
Prss32 A T 17: 23,859,247 E302D possibly damaging Het
Prss45 A G 9: 110,840,470 K205E probably damaging Het
Puf60 T A 15: 76,070,474 I500F probably damaging Het
Ryr3 A T 2: 112,640,171 I4623N probably damaging Het
Sh3bp5l T A 11: 58,338,124 probably benign Het
Slc3a1 T G 17: 85,032,845 Y232D probably damaging Het
Slc8a3 A G 12: 81,214,132 Y608H probably damaging Het
Socs7 G T 11: 97,378,643 R429L probably benign Het
Sorcs3 C A 19: 48,759,951 N786K possibly damaging Het
Sp4 A T 12: 118,254,472 M680K probably benign Het
Tas2r131 T C 6: 132,957,577 T90A probably damaging Het
Tbx21 T C 11: 97,114,710 H143R probably benign Het
Tg T A 15: 66,827,382 C833* probably null Het
Tmem245 A G 4: 56,925,057 S355P probably benign Het
Tmem86b G A 7: 4,628,466 P191S possibly damaging Het
Tnc A G 4: 64,017,986 C238R probably damaging Het
Tnn T A 1: 160,140,738 E361D probably benign Het
Tpp2 T C 1: 44,001,473 V298A possibly damaging Het
Trav7-6 A G 14: 53,717,079 N22S probably damaging Het
Trim75 T C 8: 64,982,439 probably null Het
Trrap T A 5: 144,826,717 I2492N probably damaging Het
Ufl1 G T 4: 25,254,773 A561E probably benign Het
Uqcc1 A G 2: 155,910,421 V86A probably damaging Het
Vmn1r184 A G 7: 26,267,368 I180V possibly damaging Het
Vmn1r185 A G 7: 26,611,495 F195S possibly damaging Het
Vmn2r4 A C 3: 64,398,598 probably null Het
Vmn2r87 T C 10: 130,472,429 T647A probably damaging Het
Vps13d A T 4: 145,086,766 H198Q probably damaging Het
Wdfy4 T C 14: 33,152,670 T154A possibly damaging Het
Xirp2 A G 2: 67,517,134 M3240V probably benign Het
Zfp619 G A 7: 39,535,514 V323I probably benign Het
Zfy1 A T Y: 726,004 I587N possibly damaging Het
Zswim6 C T 13: 107,726,575 noncoding transcript Het
Other mutations in Zfp101
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0189:Zfp101 UTSW 17 33382239 missense possibly damaging 0.53
R0254:Zfp101 UTSW 17 33380978 missense possibly damaging 0.71
R0448:Zfp101 UTSW 17 33382321 missense possibly damaging 0.73
R0696:Zfp101 UTSW 17 33381427 missense possibly damaging 0.86
R0834:Zfp101 UTSW 17 33382444 missense probably benign 0.33
R2000:Zfp101 UTSW 17 33381517 missense possibly damaging 0.92
R2366:Zfp101 UTSW 17 33380998 missense probably benign 0.06
R2471:Zfp101 UTSW 17 33380976 missense possibly damaging 0.85
R3713:Zfp101 UTSW 17 33381906 missense probably benign 0.05
R3857:Zfp101 UTSW 17 33382431 nonsense probably null
R4537:Zfp101 UTSW 17 33382492 missense possibly damaging 0.87
R4712:Zfp101 UTSW 17 33394483 splice site probably null
R5241:Zfp101 UTSW 17 33382236 missense probably benign
R5499:Zfp101 UTSW 17 33382344 missense probably benign 0.20
R5587:Zfp101 UTSW 17 33381321 missense possibly damaging 0.71
R5694:Zfp101 UTSW 17 33380945 missense probably benign
R5994:Zfp101 UTSW 17 33380962 missense probably benign
R6193:Zfp101 UTSW 17 33381746 nonsense probably null
R7331:Zfp101 UTSW 17 33382585 missense possibly damaging 0.53
R7393:Zfp101 UTSW 17 33386700 missense possibly damaging 0.71
R7434:Zfp101 UTSW 17 33381590 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- ACAAAGGGATTCTCTCCAGTG -3'
(R):5'- AAGTGTACATCTGACCAGATCG -3'

Sequencing Primer
(F):5'- AAGGGATTCTCTCCAGTGTGAATTC -3'
(R):5'- AGTCACCTTATCAGTCATGAGCG -3'
Posted On2016-06-15