Incidental Mutation 'R5049:Slc3a1'
ID394564
Institutional Source Beutler Lab
Gene Symbol Slc3a1
Ensembl Gene ENSMUSG00000024131
Gene Namesolute carrier family 3, member 1
SynonymsNTAA, D2H
MMRRC Submission 042639-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5049 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location85028347-85064243 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 85032845 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Aspartic acid at position 232 (Y232D)
Ref Sequence ENSEMBL: ENSMUSP00000024944 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024944]
Predicted Effect probably damaging
Transcript: ENSMUST00000024944
AA Change: Y232D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024944
Gene: ENSMUSG00000024131
AA Change: Y232D

DomainStartEndE-ValueType
transmembrane domain 87 109 N/A INTRINSIC
Aamy 124 504 6.7e-110 SMART
Meta Mutation Damage Score 0.9335 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 95.8%
  • 20x: 90.4%
Validation Efficiency 97% (89/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type II membrane glycoprotein which is one of the components of the renal amino acid transporter which transports neutral and basic amino acids in the renal tubule and intestinal tract. Mutations and deletions in this gene are associated with cystinuria. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutation of this locus results in renal absorption defects and cystine urolithiasis. Homozygous mutant mice serve as a mouse model for human cystinuria type I. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810013L24Rik T A 16: 8,843,209 D183E probably damaging Het
4932438A13Rik T A 3: 37,040,506 probably benign Het
4932438A13Rik T C 3: 37,041,390 M1016T probably damaging Het
9330182L06Rik A G 5: 9,428,488 T451A probably damaging Het
Aamp A G 1: 74,282,539 S76P probably damaging Het
Acot8 A G 2: 164,799,690 probably benign Het
Angptl7 A G 4: 148,498,011 F143L probably benign Het
Atxn7l1 A G 12: 33,358,687 T283A probably benign Het
Brd3 G T 2: 27,450,577 probably benign Het
C130026L21Rik T A 5: 111,581,836 noncoding transcript Het
Cbr4 T G 8: 61,495,204 probably null Het
Ccl19 A G 4: 42,756,268 probably null Het
Ccl2 G T 11: 82,036,507 C34F probably damaging Het
Dnah12 A T 14: 26,735,697 T873S probably benign Het
Dnah2 T C 11: 69,448,166 N3118S probably damaging Het
Epb41l1 C A 2: 156,524,939 P564Q possibly damaging Het
Extl3 A T 14: 65,076,032 M567K probably benign Het
Fam160b1 T C 19: 57,386,305 I704T possibly damaging Het
Fam208b A T 13: 3,574,000 H1983Q probably benign Het
Foxf2 T C 13: 31,627,175 S366P probably benign Het
Gamt T A 10: 80,258,954 T186S probably benign Het
Gcn1l1 T A 5: 115,606,671 M1642K probably damaging Het
Gm21738 T A 14: 19,415,957 Y194F probably benign Het
Golga1 A T 2: 39,047,735 M115K probably damaging Het
Herc3 A G 6: 58,894,539 probably null Het
Hes2 C A 4: 152,159,874 L39I possibly damaging Het
Hopx C A 5: 77,095,052 probably benign Het
Idi1 C T 13: 8,888,042 P175S probably damaging Het
Ifit1bl1 A T 19: 34,594,081 C325* probably null Het
Ighv7-3 T C 12: 114,153,333 I70V probably benign Het
Kcnq3 T C 15: 66,285,897 T110A probably benign Het
Kif5a T C 10: 127,239,839 D451G possibly damaging Het
Lama3 A G 18: 12,582,611 E1708G probably benign Het
Lrriq4 T A 3: 30,650,937 D371E probably damaging Het
Lyst T A 13: 13,636,064 V773E probably damaging Het
Map4 T A 9: 110,079,814 L23* probably null Het
Mapkbp1 G T 2: 120,015,501 probably benign Het
Mrpl30 A T 1: 37,897,710 D52V possibly damaging Het
Olfr1122 A T 2: 87,388,658 T318S probably benign Het
Olfr71 A T 4: 43,706,259 L103Q probably damaging Het
Pard3b T A 1: 62,161,161 H286Q probably benign Het
Parp4 A G 14: 56,635,731 K1144R possibly damaging Het
Pdcd11 C A 19: 47,107,115 S625R probably benign Het
Pkhd1l1 T C 15: 44,457,616 S22P probably benign Het
Prss32 A T 17: 23,859,247 E302D possibly damaging Het
Prss45 A G 9: 110,840,470 K205E probably damaging Het
Puf60 T A 15: 76,070,474 I500F probably damaging Het
Ryr3 A T 2: 112,640,171 I4623N probably damaging Het
Sh3bp5l T A 11: 58,338,124 probably benign Het
Slc8a3 A G 12: 81,214,132 Y608H probably damaging Het
Socs7 G T 11: 97,378,643 R429L probably benign Het
Sorcs3 C A 19: 48,759,951 N786K possibly damaging Het
Sp4 A T 12: 118,254,472 M680K probably benign Het
Tas2r131 T C 6: 132,957,577 T90A probably damaging Het
Tbx21 T C 11: 97,114,710 H143R probably benign Het
Tg T A 15: 66,827,382 C833* probably null Het
Tmem245 A G 4: 56,925,057 S355P probably benign Het
Tmem86b G A 7: 4,628,466 P191S possibly damaging Het
Tnc A G 4: 64,017,986 C238R probably damaging Het
Tnn T A 1: 160,140,738 E361D probably benign Het
Tpp2 T C 1: 44,001,473 V298A possibly damaging Het
Trav7-6 A G 14: 53,717,079 N22S probably damaging Het
Trim75 T C 8: 64,982,439 probably null Het
Trrap T A 5: 144,826,717 I2492N probably damaging Het
Ufl1 G T 4: 25,254,773 A561E probably benign Het
Uqcc1 A G 2: 155,910,421 V86A probably damaging Het
Vmn1r184 A G 7: 26,267,368 I180V possibly damaging Het
Vmn1r185 A G 7: 26,611,495 F195S possibly damaging Het
Vmn2r4 A C 3: 64,398,598 probably null Het
Vmn2r87 T C 10: 130,472,429 T647A probably damaging Het
Vps13d A T 4: 145,086,766 H198Q probably damaging Het
Wdfy4 T C 14: 33,152,670 T154A possibly damaging Het
Xirp2 A G 2: 67,517,134 M3240V probably benign Het
Zfp101 T C 17: 33,381,898 R295G possibly damaging Het
Zfp619 G A 7: 39,535,514 V323I probably benign Het
Zfy1 A T Y: 726,004 I587N possibly damaging Het
Zswim6 C T 13: 107,726,575 noncoding transcript Het
Other mutations in Slc3a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Slc3a1 APN 17 85060833 missense probably damaging 1.00
IGL00647:Slc3a1 APN 17 85063805 missense probably damaging 0.99
IGL02755:Slc3a1 APN 17 85037177 missense probably damaging 1.00
IGL03079:Slc3a1 APN 17 85059823 nonsense probably null
IGL03390:Slc3a1 APN 17 85032777 missense probably damaging 1.00
R0031:Slc3a1 UTSW 17 85032846 missense probably damaging 1.00
R0097:Slc3a1 UTSW 17 85032860 missense probably damaging 0.99
R0097:Slc3a1 UTSW 17 85032860 missense probably damaging 0.99
R0363:Slc3a1 UTSW 17 85032845 missense probably damaging 1.00
R0531:Slc3a1 UTSW 17 85028649 missense possibly damaging 0.66
R0636:Slc3a1 UTSW 17 85032794 missense possibly damaging 0.78
R0662:Slc3a1 UTSW 17 85037207 missense possibly damaging 0.89
R0725:Slc3a1 UTSW 17 85060835 nonsense probably null
R0930:Slc3a1 UTSW 17 85059743 missense probably benign 0.01
R1141:Slc3a1 UTSW 17 85028649 missense possibly damaging 0.66
R2025:Slc3a1 UTSW 17 85032845 missense probably damaging 1.00
R2271:Slc3a1 UTSW 17 85063792 missense probably benign 0.00
R4196:Slc3a1 UTSW 17 85060878 missense probably damaging 1.00
R4740:Slc3a1 UTSW 17 85046753 missense probably benign 0.00
R5255:Slc3a1 UTSW 17 85028453 unclassified probably null
R5261:Slc3a1 UTSW 17 85051975 missense probably damaging 1.00
R5601:Slc3a1 UTSW 17 85032891 missense probably benign 0.00
R5853:Slc3a1 UTSW 17 85032580 missense probably damaging 1.00
R6063:Slc3a1 UTSW 17 85028523 missense probably benign
R6332:Slc3a1 UTSW 17 85028432 start codon destroyed probably damaging 0.99
R7162:Slc3a1 UTSW 17 85064014 nonsense probably null
R7269:Slc3a1 UTSW 17 85032445 missense probably damaging 1.00
R7516:Slc3a1 UTSW 17 85063762 missense probably damaging 1.00
R7807:Slc3a1 UTSW 17 85063943 missense probably benign 0.09
X0020:Slc3a1 UTSW 17 85028808 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTTGCTGCCATCCATGAC -3'
(R):5'- AAAAGCTCTTGGGGCTTTTGTC -3'

Sequencing Primer
(F):5'- GTTGCTGCCATCCATGACAAAGG -3'
(R):5'- GGGGCTTTTGTCTATTTCTAACTAAC -3'
Posted On2016-06-15