Incidental Mutation 'R5049:Sorcs3'
ID394568
Institutional Source Beutler Lab
Gene Symbol Sorcs3
Ensembl Gene ENSMUSG00000063434
Gene Namesortilin-related VPS10 domain containing receptor 3
Synonyms6330404A12Rik
MMRRC Submission 042639-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R5049 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location48206025-48805505 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 48759951 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 786 (N786K)
Ref Sequence ENSEMBL: ENSMUSP00000077919 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078880]
Predicted Effect possibly damaging
Transcript: ENSMUST00000078880
AA Change: N786K

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000077919
Gene: ENSMUSG00000063434
AA Change: N786K

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 46 63 N/A INTRINSIC
low complexity region 69 91 N/A INTRINSIC
VPS10 216 818 N/A SMART
Pfam:PKD 823 901 8e-13 PFAM
transmembrane domain 1122 1141 N/A INTRINSIC
Meta Mutation Damage Score 0.1085 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 95.8%
  • 20x: 90.4%
Validation Efficiency 97% (89/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type-I receptor transmembrane protein that is a member of the vacuolar protein sorting 10 receptor family. Proteins of this family are defined by a vacuolar protein sorting 10 domain at the N-terminus. The N-terminal segment of this domain has a consensus motif for proprotein convertase processing, and the C-terminal segment of this domain is characterized by ten conserved cysteine residues. The vacuolar protein sorting 10 domain is followed by a leucine-rich segment, a transmembrane domain, and a short C-terminal cytoplasmic domain that interacts with adaptor molecules. The transcript is expressed at high levels in the brain, and candidate gene studies suggest that genetic variation in this gene is associated with Alzheimer's disease. Consistent with this observation, knockdown of the gene in cell culture results in an increase in amyloid precursor protein processing. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit absent NMDA and glutamate receptor-dependent long term depression, impaired spatial learning and memory and impaired fear memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810013L24Rik T A 16: 8,843,209 D183E probably damaging Het
4932438A13Rik T A 3: 37,040,506 probably benign Het
4932438A13Rik T C 3: 37,041,390 M1016T probably damaging Het
9330182L06Rik A G 5: 9,428,488 T451A probably damaging Het
Aamp A G 1: 74,282,539 S76P probably damaging Het
Acot8 A G 2: 164,799,690 probably benign Het
Angptl7 A G 4: 148,498,011 F143L probably benign Het
Atxn7l1 A G 12: 33,358,687 T283A probably benign Het
Brd3 G T 2: 27,450,577 probably benign Het
C130026L21Rik T A 5: 111,581,836 noncoding transcript Het
Cbr4 T G 8: 61,495,204 probably null Het
Ccl19 A G 4: 42,756,268 probably null Het
Ccl2 G T 11: 82,036,507 C34F probably damaging Het
Dnah12 A T 14: 26,735,697 T873S probably benign Het
Dnah2 T C 11: 69,448,166 N3118S probably damaging Het
Epb41l1 C A 2: 156,524,939 P564Q possibly damaging Het
Extl3 A T 14: 65,076,032 M567K probably benign Het
Fam160b1 T C 19: 57,386,305 I704T possibly damaging Het
Fam208b A T 13: 3,574,000 H1983Q probably benign Het
Foxf2 T C 13: 31,627,175 S366P probably benign Het
Gamt T A 10: 80,258,954 T186S probably benign Het
Gcn1l1 T A 5: 115,606,671 M1642K probably damaging Het
Gm21738 T A 14: 19,415,957 Y194F probably benign Het
Golga1 A T 2: 39,047,735 M115K probably damaging Het
Herc3 A G 6: 58,894,539 probably null Het
Hes2 C A 4: 152,159,874 L39I possibly damaging Het
Hopx C A 5: 77,095,052 probably benign Het
Idi1 C T 13: 8,888,042 P175S probably damaging Het
Ifit1bl1 A T 19: 34,594,081 C325* probably null Het
Ighv7-3 T C 12: 114,153,333 I70V probably benign Het
Kcnq3 T C 15: 66,285,897 T110A probably benign Het
Kif5a T C 10: 127,239,839 D451G possibly damaging Het
Lama3 A G 18: 12,582,611 E1708G probably benign Het
Lrriq4 T A 3: 30,650,937 D371E probably damaging Het
Lyst T A 13: 13,636,064 V773E probably damaging Het
Map4 T A 9: 110,079,814 L23* probably null Het
Mapkbp1 G T 2: 120,015,501 probably benign Het
Mrpl30 A T 1: 37,897,710 D52V possibly damaging Het
Olfr1122 A T 2: 87,388,658 T318S probably benign Het
Olfr71 A T 4: 43,706,259 L103Q probably damaging Het
Pard3b T A 1: 62,161,161 H286Q probably benign Het
Parp4 A G 14: 56,635,731 K1144R possibly damaging Het
Pdcd11 C A 19: 47,107,115 S625R probably benign Het
Pkhd1l1 T C 15: 44,457,616 S22P probably benign Het
Prss32 A T 17: 23,859,247 E302D possibly damaging Het
Prss45 A G 9: 110,840,470 K205E probably damaging Het
Puf60 T A 15: 76,070,474 I500F probably damaging Het
Ryr3 A T 2: 112,640,171 I4623N probably damaging Het
Sh3bp5l T A 11: 58,338,124 probably benign Het
Slc3a1 T G 17: 85,032,845 Y232D probably damaging Het
Slc8a3 A G 12: 81,214,132 Y608H probably damaging Het
Socs7 G T 11: 97,378,643 R429L probably benign Het
Sp4 A T 12: 118,254,472 M680K probably benign Het
Tas2r131 T C 6: 132,957,577 T90A probably damaging Het
Tbx21 T C 11: 97,114,710 H143R probably benign Het
Tg T A 15: 66,827,382 C833* probably null Het
Tmem245 A G 4: 56,925,057 S355P probably benign Het
Tmem86b G A 7: 4,628,466 P191S possibly damaging Het
Tnc A G 4: 64,017,986 C238R probably damaging Het
Tnn T A 1: 160,140,738 E361D probably benign Het
Tpp2 T C 1: 44,001,473 V298A possibly damaging Het
Trav7-6 A G 14: 53,717,079 N22S probably damaging Het
Trim75 T C 8: 64,982,439 probably null Het
Trrap T A 5: 144,826,717 I2492N probably damaging Het
Ufl1 G T 4: 25,254,773 A561E probably benign Het
Uqcc1 A G 2: 155,910,421 V86A probably damaging Het
Vmn1r184 A G 7: 26,267,368 I180V possibly damaging Het
Vmn1r185 A G 7: 26,611,495 F195S possibly damaging Het
Vmn2r4 A C 3: 64,398,598 probably null Het
Vmn2r87 T C 10: 130,472,429 T647A probably damaging Het
Vps13d A T 4: 145,086,766 H198Q probably damaging Het
Wdfy4 T C 14: 33,152,670 T154A possibly damaging Het
Xirp2 A G 2: 67,517,134 M3240V probably benign Het
Zfp101 T C 17: 33,381,898 R295G possibly damaging Het
Zfp619 G A 7: 39,535,514 V323I probably benign Het
Zfy1 A T Y: 726,004 I587N possibly damaging Het
Zswim6 C T 13: 107,726,575 noncoding transcript Het
Other mutations in Sorcs3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Sorcs3 APN 19 48683658 critical splice donor site probably null
IGL00233:Sorcs3 APN 19 48748319 missense probably benign 0.12
IGL00482:Sorcs3 APN 19 48603864 missense probably benign 0.00
IGL00976:Sorcs3 APN 19 48767103 missense probably damaging 1.00
IGL01367:Sorcs3 APN 19 48796375 missense probably damaging 1.00
IGL01390:Sorcs3 APN 19 48790131 missense probably damaging 1.00
IGL01548:Sorcs3 APN 19 48794168 missense possibly damaging 0.87
IGL02162:Sorcs3 APN 19 48535531 missense probably damaging 0.98
IGL02165:Sorcs3 APN 19 48654072 missense probably benign 0.03
IGL02404:Sorcs3 APN 19 48704370 splice site probably benign
IGL02830:Sorcs3 APN 19 48723002 splice site probably null
IGL02943:Sorcs3 APN 19 48759938 missense probably benign 0.00
R0371:Sorcs3 UTSW 19 48603894 missense probably benign 0.00
R0456:Sorcs3 UTSW 19 48654044 missense possibly damaging 0.94
R0466:Sorcs3 UTSW 19 48748319 missense probably benign 0.12
R0470:Sorcs3 UTSW 19 48797517 critical splice donor site probably null
R0536:Sorcs3 UTSW 19 48802698 nonsense probably null
R0646:Sorcs3 UTSW 19 48206295 missense probably benign 0.10
R0709:Sorcs3 UTSW 19 48487406 missense probably benign
R0792:Sorcs3 UTSW 19 48706009 missense possibly damaging 0.84
R0831:Sorcs3 UTSW 19 48693994 missense probably damaging 1.00
R0836:Sorcs3 UTSW 19 48487394 missense probably benign
R1253:Sorcs3 UTSW 19 48206736 missense possibly damaging 0.67
R1390:Sorcs3 UTSW 19 48694001 critical splice donor site probably null
R1522:Sorcs3 UTSW 19 48706009 missense possibly damaging 0.84
R1570:Sorcs3 UTSW 19 48764181 missense probably damaging 1.00
R1637:Sorcs3 UTSW 19 48748359 critical splice donor site probably null
R1766:Sorcs3 UTSW 19 48603875 missense possibly damaging 0.87
R1894:Sorcs3 UTSW 19 48794274 missense probably benign 0.23
R2426:Sorcs3 UTSW 19 48722925 missense probably damaging 1.00
R3789:Sorcs3 UTSW 19 48398711 missense possibly damaging 0.46
R3818:Sorcs3 UTSW 19 48603904 missense probably benign 0.00
R3824:Sorcs3 UTSW 19 48722956 missense probably damaging 1.00
R3934:Sorcs3 UTSW 19 48713504 missense probably damaging 1.00
R3936:Sorcs3 UTSW 19 48713504 missense probably damaging 1.00
R4190:Sorcs3 UTSW 19 48749373 missense possibly damaging 0.69
R4604:Sorcs3 UTSW 19 48693914 missense probably benign 0.35
R4644:Sorcs3 UTSW 19 48683597 missense probably damaging 1.00
R4774:Sorcs3 UTSW 19 48794163 missense probably benign 0.23
R4801:Sorcs3 UTSW 19 48398744 missense possibly damaging 0.46
R4802:Sorcs3 UTSW 19 48398744 missense possibly damaging 0.46
R4945:Sorcs3 UTSW 19 48764148 missense possibly damaging 0.50
R5175:Sorcs3 UTSW 19 48759845 critical splice acceptor site probably null
R5342:Sorcs3 UTSW 19 48796472 splice site probably null
R5848:Sorcs3 UTSW 19 48788511 missense probably damaging 1.00
R5959:Sorcs3 UTSW 19 48749396 missense probably damaging 1.00
R5977:Sorcs3 UTSW 19 48796450 missense probably damaging 1.00
R6155:Sorcs3 UTSW 19 48398697 missense possibly damaging 0.94
R6222:Sorcs3 UTSW 19 48759857 missense possibly damaging 0.57
R6268:Sorcs3 UTSW 19 48790166 missense probably damaging 1.00
R6416:Sorcs3 UTSW 19 48802759 missense probably damaging 1.00
R6425:Sorcs3 UTSW 19 48764307 critical splice donor site probably null
R6623:Sorcs3 UTSW 19 48788505 missense probably benign 0.00
R6767:Sorcs3 UTSW 19 48713571 missense probably damaging 0.99
R6888:Sorcs3 UTSW 19 48693824 missense possibly damaging 0.83
R6955:Sorcs3 UTSW 19 48749343 missense possibly damaging 0.82
R7106:Sorcs3 UTSW 19 48705963 missense probably damaging 1.00
R7379:Sorcs3 UTSW 19 48772266 missense possibly damaging 0.69
R8043:Sorcs3 UTSW 19 48764295 missense possibly damaging 0.84
X0018:Sorcs3 UTSW 19 48772289 missense probably damaging 1.00
Z1176:Sorcs3 UTSW 19 48645804 missense probably damaging 1.00
Z1177:Sorcs3 UTSW 19 48704300 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGTATTTGCCTCACTGGG -3'
(R):5'- TCAGATTCCCTCAAAAGCCTCTTG -3'

Sequencing Primer
(F):5'- GCCTCACTGGGGTTAATTAAAAC -3'
(R):5'- CCTCAAAAGCCTCTTGATATAAACG -3'
Posted On2016-06-15