Incidental Mutation 'R5050:Dhtkd1'
ID394575
Institutional Source Beutler Lab
Gene Symbol Dhtkd1
Ensembl Gene ENSMUSG00000025815
Gene Namedehydrogenase E1 and transketolase domain containing 1
SynonymsC330018I04Rik
MMRRC Submission 042640-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5050 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location5896115-5942792 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 5917689 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 553 (L553Q)
Ref Sequence ENSEMBL: ENSMUSP00000092769 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026924] [ENSMUST00000095147]
Predicted Effect probably benign
Transcript: ENSMUST00000026924
AA Change: L553Q

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000026924
Gene: ENSMUSG00000025815
AA Change: L553Q

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 150 165 N/A INTRINSIC
Pfam:E1_dh 193 505 2.4e-44 PFAM
Blast:Transket_pyr 523 558 9e-8 BLAST
Transket_pyr 570 773 2.1e-54 SMART
Blast:Transket_pyr 775 805 7e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000095147
AA Change: L553Q

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000092769
Gene: ENSMUSG00000025815
AA Change: L553Q

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 150 165 N/A INTRINSIC
Pfam:E1_dh 193 505 2.4e-44 PFAM
Blast:Transket_pyr 523 558 9e-8 BLAST
Transket_pyr 570 773 2.1e-54 SMART
Blast:Transket_pyr 775 805 7e-8 BLAST
Meta Mutation Damage Score 0.0596 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of a mitochondrial 2-oxoglutarate-dehydrogenase-complex-like protein involved in the degradation pathways of several amino acids, including lysine. Mutations in this gene are associated with 2-aminoadipic 2-oxoadipic aciduria and Charcot-Marie-Tooth Disease Type 2Q. [provided by RefSeq, May 2013]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak A G 19: 9,012,458 probably benign Het
Ap3m1 A G 14: 21,044,775 I108T probably benign Het
Apobec1 T C 6: 122,591,102 M1V probably null Het
Aqr A T 2: 114,112,609 L1161* probably null Het
Aqr A T 2: 114,170,025 probably null Het
Arhgef37 A G 18: 61,504,331 I420T probably benign Het
Cacna1g C T 11: 94,459,715 E435K probably damaging Het
Card6 G T 15: 5,100,376 H513N probably benign Het
Ccdc158 A C 5: 92,666,879 F29L probably benign Het
Ccr6 T C 17: 8,256,104 L47S probably damaging Het
Cdc42bpa T A 1: 180,072,453 Y444* probably null Het
Cdh17 A G 4: 11,784,654 Y270C probably damaging Het
Cdh9 T C 15: 16,778,147 F16S probably benign Het
Cdkl1 T C 12: 69,757,240 K141R probably damaging Het
Chd4 T C 6: 125,107,480 Y692H probably damaging Het
Dhrs7 T A 12: 72,657,410 D104V probably damaging Het
Dnah7a T G 1: 53,497,096 D2596A probably benign Het
Dync1li2 T C 8: 104,437,441 K151E probably damaging Het
Eno4 C T 19: 58,955,496 H297Y probably benign Het
Epg5 T A 18: 77,975,941 D976E possibly damaging Het
Fam160b1 T A 19: 57,383,170 F571L probably damaging Het
Gm1966 T C 7: 106,596,972 noncoding transcript Het
Gm4553 C A 7: 142,165,036 K218N unknown Het
Gm4788 T A 1: 139,736,840 I494F probably damaging Het
Gpld1 A T 13: 24,962,756 T234S probably benign Het
Gtpbp6 A T 5: 110,104,701 probably benign Het
Gucy2g T C 19: 55,240,935 E101G probably benign Het
Hira G A 16: 18,925,859 R442K possibly damaging Het
Hrh3 A G 2: 180,100,557 L394P probably damaging Het
Igkv1-110 T A 6: 68,271,192 F95Y probably damaging Het
Iqgap3 T G 3: 88,090,186 V223G probably damaging Het
Itpk1 T C 12: 102,704,810 T3A probably damaging Het
Jag1 A G 2: 137,085,154 V895A possibly damaging Het
Kazn G A 4: 142,118,203 probably benign Het
Large2 A T 2: 92,367,779 L282Q probably benign Het
Lgmn A G 12: 102,403,421 probably null Het
Lrp4 A T 2: 91,492,422 I1119F probably benign Het
Map3k19 T C 1: 127,823,562 H684R probably benign Het
Mier3 C T 13: 111,714,573 A367V possibly damaging Het
Mpdz A G 4: 81,295,448 V1579A probably benign Het
Mroh2b A T 15: 4,900,450 D6V possibly damaging Het
Myh7b A G 2: 155,631,750 I1568V probably benign Het
Olfr675 T A 7: 105,024,387 I198F probably damaging Het
Plch2 C T 4: 155,043,309 probably benign Het
Plek T C 11: 16,995,216 D38G probably damaging Het
Polr2f A G 15: 79,144,662 probably benign Het
Samsn1 A G 16: 75,888,757 S38P probably benign Het
Sf1 C T 19: 6,372,559 T248I probably damaging Het
Sgms2 C T 3: 131,330,356 V232M probably benign Het
Sharpin A T 15: 76,348,330 L160H probably damaging Het
Sympk C T 7: 19,036,042 R215C probably benign Het
Syn3 T C 10: 86,407,668 T136A probably benign Het
Tcam1 G A 11: 106,285,452 V335M possibly damaging Het
Tedc1 G T 12: 113,156,705 V56L possibly damaging Het
Tenm4 T C 7: 96,895,788 L2337P probably damaging Het
Ttn G A 2: 76,884,811 probably benign Het
Tysnd1 T A 10: 61,696,271 I234N probably damaging Het
Vmn2r51 T C 7: 10,100,422 K230E probably damaging Het
Other mutations in Dhtkd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00777:Dhtkd1 APN 2 5929657 missense probably damaging 1.00
IGL01544:Dhtkd1 APN 2 5913531 missense probably benign 0.00
IGL01724:Dhtkd1 APN 2 5914840 missense probably benign 0.00
IGL01726:Dhtkd1 APN 2 5942656 missense unknown
IGL02069:Dhtkd1 APN 2 5930934 nonsense probably null 0.00
IGL02476:Dhtkd1 APN 2 5930906 missense possibly damaging 0.89
IGL02662:Dhtkd1 APN 2 5899972 missense probably damaging 1.00
IGL02937:Dhtkd1 APN 2 5917905 missense possibly damaging 0.49
PIT4486001:Dhtkd1 UTSW 2 5899995 missense probably benign
R0277:Dhtkd1 UTSW 2 5914888 missense probably benign 0.00
R0323:Dhtkd1 UTSW 2 5914888 missense probably benign 0.00
R0373:Dhtkd1 UTSW 2 5911870 missense probably damaging 1.00
R0512:Dhtkd1 UTSW 2 5904091 missense probably damaging 1.00
R1497:Dhtkd1 UTSW 2 5904113 missense probably damaging 1.00
R1924:Dhtkd1 UTSW 2 5911933 missense probably damaging 1.00
R1943:Dhtkd1 UTSW 2 5932482 missense probably benign 0.11
R1976:Dhtkd1 UTSW 2 5902391 missense possibly damaging 0.95
R2057:Dhtkd1 UTSW 2 5942619 missense unknown
R5057:Dhtkd1 UTSW 2 5919513 missense probably damaging 1.00
R5133:Dhtkd1 UTSW 2 5904002 missense probably damaging 1.00
R5219:Dhtkd1 UTSW 2 5914816 missense probably benign 0.01
R5437:Dhtkd1 UTSW 2 5924119 missense probably benign 0.01
R5526:Dhtkd1 UTSW 2 5911851 missense probably damaging 1.00
R5720:Dhtkd1 UTSW 2 5903014 missense probably damaging 1.00
R6006:Dhtkd1 UTSW 2 5904025 nonsense probably null
R6155:Dhtkd1 UTSW 2 5910359 missense probably null 1.00
R6675:Dhtkd1 UTSW 2 5904078 missense probably damaging 1.00
R6870:Dhtkd1 UTSW 2 5919437 splice site probably null
R6899:Dhtkd1 UTSW 2 5917965 missense possibly damaging 0.91
R7123:Dhtkd1 UTSW 2 5917780 missense probably damaging 0.99
R7131:Dhtkd1 UTSW 2 5904070 missense probably benign 0.23
R7366:Dhtkd1 UTSW 2 5917906 missense probably benign 0.01
R7568:Dhtkd1 UTSW 2 5922087 intron probably null
R7731:Dhtkd1 UTSW 2 5924112 missense probably benign 0.07
R7874:Dhtkd1 UTSW 2 5917674 missense possibly damaging 0.72
R7957:Dhtkd1 UTSW 2 5917674 missense possibly damaging 0.72
Z1088:Dhtkd1 UTSW 2 5911874 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- ACCAACACGAGCATCAGTTG -3'
(R):5'- TAAATGACCACTTGGCCAATGTG -3'

Sequencing Primer
(F):5'- GGTGGCTCACAATCATCCGTAATG -3'
(R):5'- AATGTGGCCCACTACAGC -3'
Posted On2016-06-15