Mutagenetix > Incidental Mutation

Incidental Mutation 'R5050:Aqr'

394580

Institutional Source

Beutler Lab

Gene Symbol

Aqr

Ensembl Gene

ENSMUSG00000040383

Gene Name

aquarius

Synonyms

MMRRC Submission

042640-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5050 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

114101170-114187024 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to T at 114170025 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000099602 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043160] [ENSMUST00000102543]

AlphaFold

Q8CFQ3

Predicted Effect

probably null
Transcript: ENSMUST00000043160

SMART Domains

Protein: ENSMUSP00000047157
Gene: ENSMUSG00000040383

Domain	Start	End	E-Value	Type
Pfam:Aquarius_N	18	802	N/A	PFAM
Pfam:ResIII	797	911	8.2e-7	PFAM
Pfam:AAA_11	801	1111	9.6e-32	PFAM
Pfam:AAA_19	807	894	3.7e-11	PFAM
Pfam:AAA_12	1119	1312	2.1e-27	PFAM
low complexity region	1394	1417	N/A	INTRINSIC
low complexity region	1455	1468	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000102543

SMART Domains

Protein: ENSMUSP00000099602
Gene: ENSMUSG00000040383

Domain	Start	End	E-Value	Type
low complexity region	43	56	N/A	INTRINSIC
low complexity region	112	124	N/A	INTRINSIC
low complexity region	762	776	N/A	INTRINSIC
Pfam:AAA_11	801	1111	3.2e-32	PFAM
Pfam:AAA_19	807	893	6.5e-11	PFAM
Pfam:AAA_12	1119	1312	2.6e-27	PFAM
low complexity region	1348	1359	N/A	INTRINSIC
low complexity region	1371	1382	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125460

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129504

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131785

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147191

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154317

Meta Mutation Damage Score

0.9492

Coding Region Coverage

1x: 99.4%
3x: 98.6%
10x: 96.7%
20x: 93.6%

Validation Efficiency

100% (69/69)

MGI Phenotype

PHENOTYPE: Homozygotes for a targeted null mutation exhibit severe defects in placental vascularization with few vessels entering the placenta and little branching. Mutants die between embryonic days 9.5 and 10.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ahnak	A	G	19: 9,012,458		probably benign	Het
Ap3m1	A	G	14: 21,044,775	I108T	probably benign	Het
Apobec1	T	C	6: 122,591,102	M1V	probably null	Het
Arhgef37	A	G	18: 61,504,331	I420T	probably benign	Het
Cacna1g	C	T	11: 94,459,715	E435K	probably damaging	Het
Card6	G	T	15: 5,100,376	H513N	probably benign	Het
Ccdc158	A	C	5: 92,666,879	F29L	probably benign	Het
Ccr6	T	C	17: 8,256,104	L47S	probably damaging	Het
Cdc42bpa	T	A	1: 180,072,453	Y444*	probably null	Het
Cdh17	A	G	4: 11,784,654	Y270C	probably damaging	Het
Cdh9	T	C	15: 16,778,147	F16S	probably benign	Het
Cdkl1	T	C	12: 69,757,240	K141R	probably damaging	Het
Chd4	T	C	6: 125,107,480	Y692H	probably damaging	Het
Dhrs7	T	A	12: 72,657,410	D104V	probably damaging	Het
Dhtkd1	A	T	2: 5,917,689	L553Q	probably benign	Het
Dnah7a	T	G	1: 53,497,096	D2596A	probably benign	Het
Dync1li2	T	C	8: 104,437,441	K151E	probably damaging	Het
Eno4	C	T	19: 58,955,496	H297Y	probably benign	Het
Epg5	T	A	18: 77,975,941	D976E	possibly damaging	Het
Fam160b1	T	A	19: 57,383,170	F571L	probably damaging	Het
Gm1966	T	C	7: 106,596,972		noncoding transcript	Het
Gm4553	C	A	7: 142,165,036	K218N	unknown	Het
Gm4788	T	A	1: 139,736,840	I494F	probably damaging	Het
Gpld1	A	T	13: 24,962,756	T234S	probably benign	Het
Gtpbp6	A	T	5: 110,104,701		probably benign	Het
Gucy2g	T	C	19: 55,240,935	E101G	probably benign	Het
Hira	G	A	16: 18,925,859	R442K	possibly damaging	Het
Hrh3	A	G	2: 180,100,557	L394P	probably damaging	Het
Igkv1-110	T	A	6: 68,271,192	F95Y	probably damaging	Het
Iqgap3	T	G	3: 88,090,186	V223G	probably damaging	Het
Itpk1	T	C	12: 102,704,810	T3A	probably damaging	Het
Jag1	A	G	2: 137,085,154	V895A	possibly damaging	Het
Kazn	G	A	4: 142,118,203		probably benign	Het
Large2	A	T	2: 92,367,779	L282Q	probably benign	Het
Lgmn	A	G	12: 102,403,421		probably null	Het
Lrp4	A	T	2: 91,492,422	I1119F	probably benign	Het
Map3k19	T	C	1: 127,823,562	H684R	probably benign	Het
Mier3	C	T	13: 111,714,573	A367V	possibly damaging	Het
Mpdz	A	G	4: 81,295,448	V1579A	probably benign	Het
Mroh2b	A	T	15: 4,900,450	D6V	possibly damaging	Het
Myh7b	A	G	2: 155,631,750	I1568V	probably benign	Het
Olfr675	T	A	7: 105,024,387	I198F	probably damaging	Het
Plch2	C	T	4: 155,043,309		probably benign	Het
Plek	T	C	11: 16,995,216	D38G	probably damaging	Het
Polr2f	A	G	15: 79,144,662		probably benign	Het
Samsn1	A	G	16: 75,888,757	S38P	probably benign	Het
Sf1	C	T	19: 6,372,559	T248I	probably damaging	Het
Sgms2	C	T	3: 131,330,356	V232M	probably benign	Het
Sharpin	A	T	15: 76,348,330	L160H	probably damaging	Het
Sympk	C	T	7: 19,036,042	R215C	probably benign	Het
Syn3	T	C	10: 86,407,668	T136A	probably benign	Het
Tcam1	G	A	11: 106,285,452	V335M	possibly damaging	Het
Tedc1	G	T	12: 113,156,705	V56L	possibly damaging	Het
Tenm4	T	C	7: 96,895,788	L2337P	probably damaging	Het
Ttn	G	A	2: 76,884,811		probably benign	Het
Tysnd1	T	A	10: 61,696,271	I234N	probably damaging	Het
Vmn2r51	T	C	7: 10,100,422	K230E	probably damaging	Het

Other mutations in Aqr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00572:Aqr	APN	2	114125942	missense	possibly damaging	0.90
IGL00694:Aqr	APN	2	114151525	missense	probably damaging	1.00
IGL02113:Aqr	APN	2	114120027	nonsense	probably null
IGL02297:Aqr	APN	2	114150481	missense	probably benign	0.24
IGL02380:Aqr	APN	2	114109936	missense	probably damaging	1.00
IGL02410:Aqr	APN	2	114136917	missense	possibly damaging	0.85
IGL02413:Aqr	APN	2	114118780	missense	possibly damaging	0.87
IGL02474:Aqr	APN	2	114112646	missense	probably damaging	1.00
IGL02941:Aqr	APN	2	114113354	missense	probably damaging	1.00
IGL02981:Aqr	APN	2	114134824	splice site	probably benign
IGL03001:Aqr	APN	2	114146919	missense	probably benign
IGL03092:Aqr	APN	2	114158943	missense	probably benign	0.38
IGL03222:Aqr	APN	2	114121256	missense	probably damaging	1.00
capricorn	UTSW	2	114105882	missense	probably damaging	1.00
Goat	UTSW	2	114157575	missense	probably damaging	1.00
Pliades	UTSW	2	114132976	missense	probably damaging	1.00
sagittarius	UTSW	2	114149016	missense	probably damaging	1.00
Zodiac	UTSW	2	114108109	missense	probably damaging	0.96
PIT4531001:Aqr	UTSW	2	114130734	missense	possibly damaging	0.94
R0103:Aqr	UTSW	2	114149016	missense	probably damaging	1.00
R0103:Aqr	UTSW	2	114149016	missense	probably damaging	1.00
R0152:Aqr	UTSW	2	114159010	missense	probably benign	0.07
R0352:Aqr	UTSW	2	114170052	missense	probably damaging	1.00
R0371:Aqr	UTSW	2	114157604	missense	possibly damaging	0.80
R0374:Aqr	UTSW	2	114130611	missense	probably damaging	1.00
R0550:Aqr	UTSW	2	114132976	missense	probably damaging	1.00
R0604:Aqr	UTSW	2	114130604	missense	probably benign	0.00
R0685:Aqr	UTSW	2	114140977	missense	probably damaging	1.00
R1236:Aqr	UTSW	2	114116655	missense	probably damaging	1.00
R1434:Aqr	UTSW	2	114150409	missense	probably damaging	1.00
R1806:Aqr	UTSW	2	114161652	missense	probably damaging	1.00
R2154:Aqr	UTSW	2	114137004	missense	probably damaging	1.00
R2185:Aqr	UTSW	2	114130534	critical splice donor site	probably null
R2377:Aqr	UTSW	2	114140940	missense	possibly damaging	0.58
R2862:Aqr	UTSW	2	114136917	missense	probably damaging	1.00
R3615:Aqr	UTSW	2	114136887	missense	probably damaging	1.00
R3616:Aqr	UTSW	2	114136887	missense	probably damaging	1.00
R3713:Aqr	UTSW	2	114118669	splice site	probably benign
R3715:Aqr	UTSW	2	114118669	splice site	probably benign
R4586:Aqr	UTSW	2	114112577	missense	probably benign	0.06
R4663:Aqr	UTSW	2	114161666	nonsense	probably null
R4809:Aqr	UTSW	2	114175214	utr 5 prime	probably benign
R4887:Aqr	UTSW	2	114150509	missense	probably damaging	1.00
R4888:Aqr	UTSW	2	114150509	missense	probably damaging	1.00
R4952:Aqr	UTSW	2	114109937	missense	probably damaging	1.00
R4974:Aqr	UTSW	2	114113351	missense	probably damaging	1.00
R5050:Aqr	UTSW	2	114112609	nonsense	probably null
R5213:Aqr	UTSW	2	114113327	missense	probably damaging	1.00
R5263:Aqr	UTSW	2	114116578	missense	probably damaging	1.00
R5470:Aqr	UTSW	2	114157575	missense	probably damaging	1.00
R5488:Aqr	UTSW	2	114133073	missense	probably damaging	1.00
R5489:Aqr	UTSW	2	114133073	missense	probably damaging	1.00
R5567:Aqr	UTSW	2	114148970	missense	probably damaging	1.00
R5570:Aqr	UTSW	2	114148970	missense	probably damaging	1.00
R5641:Aqr	UTSW	2	114149034	missense	probably damaging	1.00
R5685:Aqr	UTSW	2	114156265	missense	possibly damaging	0.87
R5963:Aqr	UTSW	2	114126961	missense	probably damaging	1.00
R5992:Aqr	UTSW	2	114143049	nonsense	probably null
R6015:Aqr	UTSW	2	114175165	start codon destroyed	probably null	0.53
R6253:Aqr	UTSW	2	114156277	missense	possibly damaging	0.93
R6264:Aqr	UTSW	2	114109964	missense	probably damaging	1.00
R6773:Aqr	UTSW	2	114148996	missense	possibly damaging	0.64
R6877:Aqr	UTSW	2	114116571	nonsense	probably null
R7211:Aqr	UTSW	2	114134723	missense	probably benign	0.01
R7232:Aqr	UTSW	2	114105882	missense	probably damaging	1.00
R7308:Aqr	UTSW	2	114104062	missense	possibly damaging	0.86
R7396:Aqr	UTSW	2	114119946	nonsense	probably null
R7490:Aqr	UTSW	2	114158868	critical splice donor site	probably null
R7526:Aqr	UTSW	2	114108109	missense	probably damaging	0.96
R7629:Aqr	UTSW	2	114114593	missense	probably damaging	1.00
R7828:Aqr	UTSW	2	114149016	missense	probably damaging	1.00
R8037:Aqr	UTSW	2	114161680	missense	probably damaging	1.00
R8166:Aqr	UTSW	2	114113325	missense	possibly damaging	0.95
R8712:Aqr	UTSW	2	114118877	missense	probably damaging	1.00
R8904:Aqr	UTSW	2	114136993	missense	probably damaging	0.98
R9487:Aqr	UTSW	2	114104047	missense	probably benign	0.04
R9527:Aqr	UTSW	2	114101556	missense	probably benign	0.02
R9664:Aqr	UTSW	2	114140915	nonsense	probably null
Z1176:Aqr	UTSW	2	114108122	missense	probably damaging	0.98
Z1176:Aqr	UTSW	2	114109991	missense	probably benign	0.25

Predicted Primers

PCR Primer
(F):5'- CTGATCTGACTCTGAAACTAGAAGAC -3'
(R):5'- GTCATTACTGAAAAGGCTCCTGTTAG -3'

Sequencing Primer
(F):5'- TGACTCTGAAACTAGAAGACACAGAG -3'
(R):5'- TGAAAAGGCTCCTGTTAGAATATTTG -3'

Posted On

2016-06-15