Incidental Mutation 'R5050:Sgms2'
ID394584
Institutional Source Beutler Lab
Gene Symbol Sgms2
Ensembl Gene ENSMUSG00000050931
Gene Namesphingomyelin synthase 2
Synonyms4933405A16Rik, 5133401H06Rik
MMRRC Submission 042640-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.174) question?
Stock #R5050 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location131318985-131491411 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 131330356 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 232 (V232M)
Ref Sequence ENSEMBL: ENSMUSP00000087713 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090246]
Predicted Effect probably benign
Transcript: ENSMUST00000090246
AA Change: V232M

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000087713
Gene: ENSMUSG00000050931
AA Change: V232M

DomainStartEndE-ValueType
low complexity region 32 41 N/A INTRINSIC
transmembrane domain 79 101 N/A INTRINSIC
transmembrane domain 127 149 N/A INTRINSIC
transmembrane domain 154 176 N/A INTRINSIC
Pfam:PAP2_C 220 293 5.5e-29 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: Sphingomyelin, a major component of cell and Golgi membranes, is made by the transfer of phosphocholine from phosphatidylcholine onto ceramide, with diacylglycerol as a side product. The protein encoded by this gene is an enzyme that catalyzes this reaction primarily at the cell membrane. The synthesis is reversible, and this enzyme can catalyze the reaction in either direction. The encoded protein is required for cell growth. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased ceramide levels; decreased sphingomyelin, sphingomyelin-1-phosphate, and diacylglycerol levels; and resistance to lysenin-mediated cytolysis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak A G 19: 9,012,458 probably benign Het
Ap3m1 A G 14: 21,044,775 I108T probably benign Het
Apobec1 T C 6: 122,591,102 M1V probably null Het
Aqr A T 2: 114,112,609 L1161* probably null Het
Aqr A T 2: 114,170,025 probably null Het
Arhgef37 A G 18: 61,504,331 I420T probably benign Het
Cacna1g C T 11: 94,459,715 E435K probably damaging Het
Card6 G T 15: 5,100,376 H513N probably benign Het
Ccdc158 A C 5: 92,666,879 F29L probably benign Het
Ccr6 T C 17: 8,256,104 L47S probably damaging Het
Cdc42bpa T A 1: 180,072,453 Y444* probably null Het
Cdh17 A G 4: 11,784,654 Y270C probably damaging Het
Cdh9 T C 15: 16,778,147 F16S probably benign Het
Cdkl1 T C 12: 69,757,240 K141R probably damaging Het
Chd4 T C 6: 125,107,480 Y692H probably damaging Het
Dhrs7 T A 12: 72,657,410 D104V probably damaging Het
Dhtkd1 A T 2: 5,917,689 L553Q probably benign Het
Dnah7a T G 1: 53,497,096 D2596A probably benign Het
Dync1li2 T C 8: 104,437,441 K151E probably damaging Het
Eno4 C T 19: 58,955,496 H297Y probably benign Het
Epg5 T A 18: 77,975,941 D976E possibly damaging Het
Fam160b1 T A 19: 57,383,170 F571L probably damaging Het
Gm1966 T C 7: 106,596,972 noncoding transcript Het
Gm4553 C A 7: 142,165,036 K218N unknown Het
Gm4788 T A 1: 139,736,840 I494F probably damaging Het
Gpld1 A T 13: 24,962,756 T234S probably benign Het
Gtpbp6 A T 5: 110,104,701 probably benign Het
Gucy2g T C 19: 55,240,935 E101G probably benign Het
Hira G A 16: 18,925,859 R442K possibly damaging Het
Hrh3 A G 2: 180,100,557 L394P probably damaging Het
Igkv1-110 T A 6: 68,271,192 F95Y probably damaging Het
Iqgap3 T G 3: 88,090,186 V223G probably damaging Het
Itpk1 T C 12: 102,704,810 T3A probably damaging Het
Jag1 A G 2: 137,085,154 V895A possibly damaging Het
Kazn G A 4: 142,118,203 probably benign Het
Large2 A T 2: 92,367,779 L282Q probably benign Het
Lgmn A G 12: 102,403,421 probably null Het
Lrp4 A T 2: 91,492,422 I1119F probably benign Het
Map3k19 T C 1: 127,823,562 H684R probably benign Het
Mier3 C T 13: 111,714,573 A367V possibly damaging Het
Mpdz A G 4: 81,295,448 V1579A probably benign Het
Mroh2b A T 15: 4,900,450 D6V possibly damaging Het
Myh7b A G 2: 155,631,750 I1568V probably benign Het
Olfr675 T A 7: 105,024,387 I198F probably damaging Het
Plch2 C T 4: 155,043,309 probably benign Het
Plek T C 11: 16,995,216 D38G probably damaging Het
Polr2f A G 15: 79,144,662 probably benign Het
Samsn1 A G 16: 75,888,757 S38P probably benign Het
Sf1 C T 19: 6,372,559 T248I probably damaging Het
Sharpin A T 15: 76,348,330 L160H probably damaging Het
Sympk C T 7: 19,036,042 R215C probably benign Het
Syn3 T C 10: 86,407,668 T136A probably benign Het
Tcam1 G A 11: 106,285,452 V335M possibly damaging Het
Tedc1 G T 12: 113,156,705 V56L possibly damaging Het
Tenm4 T C 7: 96,895,788 L2337P probably damaging Het
Ttn G A 2: 76,884,811 probably benign Het
Tysnd1 T A 10: 61,696,271 I234N probably damaging Het
Vmn2r51 T C 7: 10,100,422 K230E probably damaging Het
Other mutations in Sgms2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00592:Sgms2 APN 3 131341833 missense possibly damaging 0.91
IGL01839:Sgms2 APN 3 131342102 missense possibly damaging 0.92
IGL02232:Sgms2 APN 3 131323184 missense probably benign
R0602:Sgms2 UTSW 3 131325107 critical splice acceptor site probably null
R2183:Sgms2 UTSW 3 131336285 splice site probably null
R4393:Sgms2 UTSW 3 131341817 unclassified probably null
R4457:Sgms2 UTSW 3 131325016 missense probably damaging 1.00
R5052:Sgms2 UTSW 3 131330356 missense probably benign
R5088:Sgms2 UTSW 3 131330356 missense probably benign
R5224:Sgms2 UTSW 3 131342117 missense probably damaging 0.98
R5426:Sgms2 UTSW 3 131341797 missense probably benign 0.01
R5682:Sgms2 UTSW 3 131324962 missense probably damaging 0.99
R5735:Sgms2 UTSW 3 131336217 missense probably damaging 1.00
R6892:Sgms2 UTSW 3 131342154 missense probably benign
R7149:Sgms2 UTSW 3 131336259 missense possibly damaging 0.78
R7762:Sgms2 UTSW 3 131323249 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- TGTATCCACGAGTGACGAAG -3'
(R):5'- AGATACACATCACAGCCTGGTG -3'

Sequencing Primer
(F):5'- GTGAATGGCAAAGCGCATGC -3'
(R):5'- TGGTGACTTTTCTATCCGAATCG -3'
Posted On2016-06-15