Incidental Mutation 'R5050:Gtpbp6'
ID394588
Institutional Source Beutler Lab
Gene Symbol Gtpbp6
Ensembl Gene ENSMUSG00000033434
Gene NameGTP binding protein 6 (putative)
SynonymsPgbpll, pgpl
MMRRC Submission 042640-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5050 (G1)
Quality Score111
Status Validated
Chromosome5
Chromosomal Location110103975-110108197 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 110104701 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119248 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077220] [ENSMUST00000086687] [ENSMUST00000112534] [ENSMUST00000135409] [ENSMUST00000140538] [ENSMUST00000141066]
Predicted Effect probably benign
Transcript: ENSMUST00000077220
SMART Domains Protein: ENSMUSP00000076458
Gene: ENSMUSG00000033434

DomainStartEndE-ValueType
low complexity region 50 83 N/A INTRINSIC
Pfam:GTP-bdg_N 107 198 9.1e-15 PFAM
Pfam:GTP-bdg_M 200 279 1.9e-17 PFAM
Pfam:MMR_HSR1 286 404 3.1e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000086687
SMART Domains Protein: ENSMUSP00000083892
Gene: ENSMUSG00000064247

DomainStartEndE-ValueType
SCOP:d2ptd__ 48 355 1e-70 SMART
PDB:1AOD|A 57 228 1e-12 PDB
Blast:PLCXc 70 228 8e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000112534
SMART Domains Protein: ENSMUSP00000108153
Gene: ENSMUSG00000064247

DomainStartEndE-ValueType
SCOP:d2ptd__ 1 111 2e-21 SMART
PDB:1AOD|A 7 95 3e-6 PDB
Blast:PLCXc 15 121 4e-8 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125748
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127628
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131774
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131918
Predicted Effect probably benign
Transcript: ENSMUST00000135409
SMART Domains Protein: ENSMUSP00000117817
Gene: ENSMUSG00000033434

DomainStartEndE-ValueType
low complexity region 162 173 N/A INTRINSIC
coiled coil region 185 218 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136722
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138507
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138881
Predicted Effect probably benign
Transcript: ENSMUST00000140538
Predicted Effect probably benign
Transcript: ENSMUST00000141066
SMART Domains Protein: ENSMUSP00000119248
Gene: ENSMUSG00000064247

DomainStartEndE-ValueType
SCOP:d2ptd__ 1 97 6e-20 SMART
PDB:1AOD|A 7 95 3e-6 PDB
Blast:PLCXc 15 99 5e-7 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144162
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149227
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199496
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a GTP binding protein and is located in the pseudoautosomal region (PAR) at the end of the short arms of the X and Y chromosomes. [provided by RefSeq, Nov 2011]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak A G 19: 9,012,458 probably benign Het
Ap3m1 A G 14: 21,044,775 I108T probably benign Het
Apobec1 T C 6: 122,591,102 M1V probably null Het
Aqr A T 2: 114,112,609 L1161* probably null Het
Aqr A T 2: 114,170,025 probably null Het
Arhgef37 A G 18: 61,504,331 I420T probably benign Het
Cacna1g C T 11: 94,459,715 E435K probably damaging Het
Card6 G T 15: 5,100,376 H513N probably benign Het
Ccdc158 A C 5: 92,666,879 F29L probably benign Het
Ccr6 T C 17: 8,256,104 L47S probably damaging Het
Cdc42bpa T A 1: 180,072,453 Y444* probably null Het
Cdh17 A G 4: 11,784,654 Y270C probably damaging Het
Cdh9 T C 15: 16,778,147 F16S probably benign Het
Cdkl1 T C 12: 69,757,240 K141R probably damaging Het
Chd4 T C 6: 125,107,480 Y692H probably damaging Het
Dhrs7 T A 12: 72,657,410 D104V probably damaging Het
Dhtkd1 A T 2: 5,917,689 L553Q probably benign Het
Dnah7a T G 1: 53,497,096 D2596A probably benign Het
Dync1li2 T C 8: 104,437,441 K151E probably damaging Het
Eno4 C T 19: 58,955,496 H297Y probably benign Het
Epg5 T A 18: 77,975,941 D976E possibly damaging Het
Fam160b1 T A 19: 57,383,170 F571L probably damaging Het
Gm1966 T C 7: 106,596,972 noncoding transcript Het
Gm4553 C A 7: 142,165,036 K218N unknown Het
Gm4788 T A 1: 139,736,840 I494F probably damaging Het
Gpld1 A T 13: 24,962,756 T234S probably benign Het
Gucy2g T C 19: 55,240,935 E101G probably benign Het
Hira G A 16: 18,925,859 R442K possibly damaging Het
Hrh3 A G 2: 180,100,557 L394P probably damaging Het
Igkv1-110 T A 6: 68,271,192 F95Y probably damaging Het
Iqgap3 T G 3: 88,090,186 V223G probably damaging Het
Itpk1 T C 12: 102,704,810 T3A probably damaging Het
Jag1 A G 2: 137,085,154 V895A possibly damaging Het
Kazn G A 4: 142,118,203 probably benign Het
Large2 A T 2: 92,367,779 L282Q probably benign Het
Lgmn A G 12: 102,403,421 probably null Het
Lrp4 A T 2: 91,492,422 I1119F probably benign Het
Map3k19 T C 1: 127,823,562 H684R probably benign Het
Mier3 C T 13: 111,714,573 A367V possibly damaging Het
Mpdz A G 4: 81,295,448 V1579A probably benign Het
Mroh2b A T 15: 4,900,450 D6V possibly damaging Het
Myh7b A G 2: 155,631,750 I1568V probably benign Het
Olfr675 T A 7: 105,024,387 I198F probably damaging Het
Plch2 C T 4: 155,043,309 probably benign Het
Plek T C 11: 16,995,216 D38G probably damaging Het
Polr2f A G 15: 79,144,662 probably benign Het
Samsn1 A G 16: 75,888,757 S38P probably benign Het
Sf1 C T 19: 6,372,559 T248I probably damaging Het
Sgms2 C T 3: 131,330,356 V232M probably benign Het
Sharpin A T 15: 76,348,330 L160H probably damaging Het
Sympk C T 7: 19,036,042 R215C probably benign Het
Syn3 T C 10: 86,407,668 T136A probably benign Het
Tcam1 G A 11: 106,285,452 V335M possibly damaging Het
Tedc1 G T 12: 113,156,705 V56L possibly damaging Het
Tenm4 T C 7: 96,895,788 L2337P probably damaging Het
Ttn G A 2: 76,884,811 probably benign Het
Tysnd1 T A 10: 61,696,271 I234N probably damaging Het
Vmn2r51 T C 7: 10,100,422 K230E probably damaging Het
Other mutations in Gtpbp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01712:Gtpbp6 APN 5 110104379 missense probably benign 0.08
IGL03330:Gtpbp6 APN 5 110107063 missense possibly damaging 0.95
R0457:Gtpbp6 UTSW 5 110106742 missense probably damaging 1.00
R1424:Gtpbp6 UTSW 5 110104289 unclassified probably null
R2012:Gtpbp6 UTSW 5 110104924 missense probably damaging 0.98
R2048:Gtpbp6 UTSW 5 110107065 missense probably damaging 1.00
R4520:Gtpbp6 UTSW 5 110107859 missense probably benign 0.41
R4629:Gtpbp6 UTSW 5 110106908 missense possibly damaging 0.95
R4762:Gtpbp6 UTSW 5 110104320 missense probably damaging 1.00
R4878:Gtpbp6 UTSW 5 110107311 unclassified probably benign
R5174:Gtpbp6 UTSW 5 110108117 missense possibly damaging 0.91
R5327:Gtpbp6 UTSW 5 110106904 missense probably damaging 1.00
R5450:Gtpbp6 UTSW 5 110107125 missense probably damaging 0.99
R5685:Gtpbp6 UTSW 5 110104939 missense probably damaging 1.00
R5773:Gtpbp6 UTSW 5 110106891 missense possibly damaging 0.94
R5793:Gtpbp6 UTSW 5 110107228 missense probably benign 0.01
R7205:Gtpbp6 UTSW 5 110104612 missense probably damaging 1.00
R7263:Gtpbp6 UTSW 5 110104049 missense probably benign 0.01
R7623:Gtpbp6 UTSW 5 110105084 missense probably damaging 1.00
R7790:Gtpbp6 UTSW 5 110104386 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGCTGTGAACCTCCAACGC -3'
(R):5'- AGCCTGATCCATGCGTTCTC -3'

Sequencing Primer
(F):5'- TGTGAACCTCCAACGCTGACTC -3'
(R):5'- ACTGGAGGACGTGGCTTACTC -3'
Posted On2016-06-15