Incidental Mutation 'R5050:Chd4'
ID394591
Institutional Source Beutler Lab
Gene Symbol Chd4
Ensembl Gene ENSMUSG00000063870
Gene Namechromodomain helicase DNA binding protein 4
SynonymsD6Ertd380e, Mi-2beta, 9530019N15Rik
MMRRC Submission 042640-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5050 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location125095981-125130591 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 125107480 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 692 (Y692H)
Ref Sequence ENSEMBL: ENSMUSP00000108011 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056889] [ENSMUST00000112390] [ENSMUST00000112392]
Predicted Effect probably damaging
Transcript: ENSMUST00000056889
AA Change: Y705H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000060054
Gene: ENSMUSG00000063870
AA Change: Y705H

DomainStartEndE-ValueType
low complexity region 29 45 N/A INTRINSIC
low complexity region 49 69 N/A INTRINSIC
low complexity region 80 92 N/A INTRINSIC
low complexity region 107 144 N/A INTRINSIC
Pfam:CHDNT 156 210 7.7e-35 PFAM
low complexity region 217 249 N/A INTRINSIC
low complexity region 271 291 N/A INTRINSIC
low complexity region 296 318 N/A INTRINSIC
low complexity region 321 347 N/A INTRINSIC
PHD 365 408 7.17e-15 SMART
RING 366 407 7.46e-1 SMART
low complexity region 424 443 N/A INTRINSIC
PHD 444 487 4.41e-15 SMART
RING 445 486 2.63e0 SMART
CHROMO 492 572 8.11e-17 SMART
CHROMO 613 670 1.98e-11 SMART
low complexity region 675 694 N/A INTRINSIC
DEXDc 715 927 2.73e-37 SMART
low complexity region 1044 1056 N/A INTRINSIC
HELICc 1073 1157 7.61e-27 SMART
DUF1087 1282 1346 5.56e-33 SMART
DUF1086 1359 1516 4.05e-108 SMART
low complexity region 1526 1540 N/A INTRINSIC
low complexity region 1560 1578 N/A INTRINSIC
low complexity region 1590 1633 N/A INTRINSIC
low complexity region 1635 1653 N/A INTRINSIC
low complexity region 1661 1674 N/A INTRINSIC
Pfam:CHDCT2 1727 1899 1.9e-98 PFAM
low complexity region 1903 1915 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112390
AA Change: Y712H

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000108009
Gene: ENSMUSG00000063870
AA Change: Y712H

DomainStartEndE-ValueType
low complexity region 29 45 N/A INTRINSIC
low complexity region 49 69 N/A INTRINSIC
low complexity region 87 99 N/A INTRINSIC
low complexity region 114 151 N/A INTRINSIC
Pfam:CHDNT 164 217 2e-28 PFAM
low complexity region 224 256 N/A INTRINSIC
low complexity region 278 298 N/A INTRINSIC
low complexity region 303 325 N/A INTRINSIC
low complexity region 328 354 N/A INTRINSIC
PHD 372 415 7.17e-15 SMART
RING 373 414 7.46e-1 SMART
low complexity region 431 450 N/A INTRINSIC
PHD 451 494 4.41e-15 SMART
RING 452 493 2.63e0 SMART
CHROMO 499 579 8.11e-17 SMART
CHROMO 620 677 1.98e-11 SMART
low complexity region 682 701 N/A INTRINSIC
DEXDc 722 934 2.73e-37 SMART
low complexity region 1051 1063 N/A INTRINSIC
HELICc 1080 1164 7.61e-27 SMART
DUF1087 1289 1353 5.56e-33 SMART
DUF1086 1366 1523 4.05e-108 SMART
low complexity region 1533 1547 N/A INTRINSIC
low complexity region 1567 1585 N/A INTRINSIC
low complexity region 1597 1640 N/A INTRINSIC
low complexity region 1642 1660 N/A INTRINSIC
low complexity region 1668 1681 N/A INTRINSIC
Pfam:CHDCT2 1735 1906 4.3e-90 PFAM
low complexity region 1910 1922 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112392
AA Change: Y692H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108011
Gene: ENSMUSG00000063870
AA Change: Y692H

DomainStartEndE-ValueType
low complexity region 29 45 N/A INTRINSIC
low complexity region 49 69 N/A INTRINSIC
low complexity region 80 92 N/A INTRINSIC
low complexity region 107 144 N/A INTRINSIC
Pfam:CHDNT 156 210 1.1e-34 PFAM
low complexity region 217 249 N/A INTRINSIC
low complexity region 271 291 N/A INTRINSIC
low complexity region 296 318 N/A INTRINSIC
low complexity region 321 347 N/A INTRINSIC
PHD 352 395 7.17e-15 SMART
RING 353 394 7.46e-1 SMART
low complexity region 411 430 N/A INTRINSIC
PHD 431 474 4.41e-15 SMART
RING 432 473 2.63e0 SMART
CHROMO 479 559 8.11e-17 SMART
CHROMO 600 657 1.98e-11 SMART
low complexity region 662 681 N/A INTRINSIC
DEXDc 702 914 2.73e-37 SMART
low complexity region 1031 1043 N/A INTRINSIC
HELICc 1060 1144 7.61e-27 SMART
DUF1087 1269 1333 5.56e-33 SMART
DUF1086 1346 1503 4.05e-108 SMART
low complexity region 1513 1527 N/A INTRINSIC
low complexity region 1547 1565 N/A INTRINSIC
low complexity region 1577 1620 N/A INTRINSIC
low complexity region 1622 1640 N/A INTRINSIC
low complexity region 1648 1661 N/A INTRINSIC
Pfam:CHDCT2 1714 1886 2.8e-98 PFAM
low complexity region 1890 1902 N/A INTRINSIC
Meta Mutation Damage Score 0.2000 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the SNF2/RAD54 helicase family. It represents the main component of the nucleosome remodeling and deacetylase complex and plays an important role in epigenetic transcriptional repression. Patients with dermatomyositis develop antibodies against this protein. Somatic mutations in this gene are associated with serous endometrial tumors. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit embryonic lethality between E3.5 and E4.5, absent blastocoele failure of trophectoderm function and increased apoptosis in blastocysts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak A G 19: 9,012,458 probably benign Het
Ap3m1 A G 14: 21,044,775 I108T probably benign Het
Apobec1 T C 6: 122,591,102 M1V probably null Het
Aqr A T 2: 114,112,609 L1161* probably null Het
Aqr A T 2: 114,170,025 probably null Het
Arhgef37 A G 18: 61,504,331 I420T probably benign Het
Cacna1g C T 11: 94,459,715 E435K probably damaging Het
Card6 G T 15: 5,100,376 H513N probably benign Het
Ccdc158 A C 5: 92,666,879 F29L probably benign Het
Ccr6 T C 17: 8,256,104 L47S probably damaging Het
Cdc42bpa T A 1: 180,072,453 Y444* probably null Het
Cdh17 A G 4: 11,784,654 Y270C probably damaging Het
Cdh9 T C 15: 16,778,147 F16S probably benign Het
Cdkl1 T C 12: 69,757,240 K141R probably damaging Het
Dhrs7 T A 12: 72,657,410 D104V probably damaging Het
Dhtkd1 A T 2: 5,917,689 L553Q probably benign Het
Dnah7a T G 1: 53,497,096 D2596A probably benign Het
Dync1li2 T C 8: 104,437,441 K151E probably damaging Het
Eno4 C T 19: 58,955,496 H297Y probably benign Het
Epg5 T A 18: 77,975,941 D976E possibly damaging Het
Fam160b1 T A 19: 57,383,170 F571L probably damaging Het
Gm1966 T C 7: 106,596,972 noncoding transcript Het
Gm4553 C A 7: 142,165,036 K218N unknown Het
Gm4788 T A 1: 139,736,840 I494F probably damaging Het
Gpld1 A T 13: 24,962,756 T234S probably benign Het
Gtpbp6 A T 5: 110,104,701 probably benign Het
Gucy2g T C 19: 55,240,935 E101G probably benign Het
Hira G A 16: 18,925,859 R442K possibly damaging Het
Hrh3 A G 2: 180,100,557 L394P probably damaging Het
Igkv1-110 T A 6: 68,271,192 F95Y probably damaging Het
Iqgap3 T G 3: 88,090,186 V223G probably damaging Het
Itpk1 T C 12: 102,704,810 T3A probably damaging Het
Jag1 A G 2: 137,085,154 V895A possibly damaging Het
Kazn G A 4: 142,118,203 probably benign Het
Large2 A T 2: 92,367,779 L282Q probably benign Het
Lgmn A G 12: 102,403,421 probably null Het
Lrp4 A T 2: 91,492,422 I1119F probably benign Het
Map3k19 T C 1: 127,823,562 H684R probably benign Het
Mier3 C T 13: 111,714,573 A367V possibly damaging Het
Mpdz A G 4: 81,295,448 V1579A probably benign Het
Mroh2b A T 15: 4,900,450 D6V possibly damaging Het
Myh7b A G 2: 155,631,750 I1568V probably benign Het
Olfr675 T A 7: 105,024,387 I198F probably damaging Het
Plch2 C T 4: 155,043,309 probably benign Het
Plek T C 11: 16,995,216 D38G probably damaging Het
Polr2f A G 15: 79,144,662 probably benign Het
Samsn1 A G 16: 75,888,757 S38P probably benign Het
Sf1 C T 19: 6,372,559 T248I probably damaging Het
Sgms2 C T 3: 131,330,356 V232M probably benign Het
Sharpin A T 15: 76,348,330 L160H probably damaging Het
Sympk C T 7: 19,036,042 R215C probably benign Het
Syn3 T C 10: 86,407,668 T136A probably benign Het
Tcam1 G A 11: 106,285,452 V335M possibly damaging Het
Tedc1 G T 12: 113,156,705 V56L possibly damaging Het
Tenm4 T C 7: 96,895,788 L2337P probably damaging Het
Ttn G A 2: 76,884,811 probably benign Het
Tysnd1 T A 10: 61,696,271 I234N probably damaging Het
Vmn2r51 T C 7: 10,100,422 K230E probably damaging Het
Other mutations in Chd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00573:Chd4 APN 6 125109897 missense probably damaging 1.00
IGL00917:Chd4 APN 6 125104946 missense possibly damaging 0.95
IGL01088:Chd4 APN 6 125122468 unclassified probably benign
IGL02005:Chd4 APN 6 125128816 missense possibly damaging 0.71
IGL02405:Chd4 APN 6 125097227 missense probably benign 0.06
IGL02707:Chd4 APN 6 125108767 missense probably damaging 1.00
IGL02976:Chd4 APN 6 125121368 missense probably damaging 1.00
IGL03001:Chd4 APN 6 125101566 missense possibly damaging 0.93
FR4304:Chd4 UTSW 6 125122144 unclassified probably benign
FR4589:Chd4 UTSW 6 125122133 missense probably benign 0.02
FR4589:Chd4 UTSW 6 125122139 unclassified probably benign
FR4737:Chd4 UTSW 6 125122131 unclassified probably benign
FR4976:Chd4 UTSW 6 125122131 unclassified probably benign
R0311:Chd4 UTSW 6 125101665 missense probably benign 0.15
R0414:Chd4 UTSW 6 125107480 missense probably damaging 1.00
R0647:Chd4 UTSW 6 125109123 missense probably damaging 1.00
R0656:Chd4 UTSW 6 125102967 missense probably damaging 0.98
R1342:Chd4 UTSW 6 125097188 missense probably benign 0.40
R1651:Chd4 UTSW 6 125123584 missense possibly damaging 0.92
R1850:Chd4 UTSW 6 125121656 missense probably damaging 1.00
R2190:Chd4 UTSW 6 125114297 missense probably benign 0.18
R2192:Chd4 UTSW 6 125105357 missense probably damaging 0.99
R2858:Chd4 UTSW 6 125104886 missense probably damaging 0.99
R3406:Chd4 UTSW 6 125122007 missense probably benign 0.09
R3431:Chd4 UTSW 6 125120560 splice site probably benign
R4330:Chd4 UTSW 6 125101602 missense probably benign 0.29
R4394:Chd4 UTSW 6 125121618 missense probably damaging 0.99
R4538:Chd4 UTSW 6 125120686 missense probably damaging 0.99
R4664:Chd4 UTSW 6 125101502 missense possibly damaging 0.58
R4805:Chd4 UTSW 6 125128945 missense possibly damaging 0.86
R5055:Chd4 UTSW 6 125100986 missense possibly damaging 0.65
R5232:Chd4 UTSW 6 125121310 missense probably damaging 1.00
R5314:Chd4 UTSW 6 125100588 missense probably damaging 0.96
R5343:Chd4 UTSW 6 125120363 missense probably damaging 1.00
R5502:Chd4 UTSW 6 125105276 missense possibly damaging 0.83
R5613:Chd4 UTSW 6 125120546 missense probably damaging 0.99
R6211:Chd4 UTSW 6 125101285 missense possibly damaging 0.82
R6606:Chd4 UTSW 6 125109426 missense probably damaging 0.99
R6753:Chd4 UTSW 6 125114300 missense probably benign 0.01
R6808:Chd4 UTSW 6 125122123 missense possibly damaging 0.53
R6939:Chd4 UTSW 6 125106538 missense probably damaging 0.99
R6968:Chd4 UTSW 6 125108318 missense probably damaging 1.00
R6973:Chd4 UTSW 6 125122862 missense possibly damaging 0.53
R6992:Chd4 UTSW 6 125114376 missense probably benign 0.14
R7058:Chd4 UTSW 6 125108442 missense possibly damaging 0.74
R7081:Chd4 UTSW 6 125129985 missense unknown
R7253:Chd4 UTSW 6 125106592 intron probably null
R7423:Chd4 UTSW 6 125128859 missense possibly damaging 0.92
R7535:Chd4 UTSW 6 125128873 missense probably benign 0.32
R7566:Chd4 UTSW 6 125101903 missense possibly damaging 0.86
RF046:Chd4 UTSW 6 125122131 unclassified probably benign
RF052:Chd4 UTSW 6 125122145 unclassified probably benign
RF058:Chd4 UTSW 6 125122131 unclassified probably benign
RF060:Chd4 UTSW 6 125122145 unclassified probably benign
X0025:Chd4 UTSW 6 125106467 nonsense probably null
X0027:Chd4 UTSW 6 125102164 missense probably damaging 0.98
X0063:Chd4 UTSW 6 125114015 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGGATTCTTTGGCTACTCCAC -3'
(R):5'- AAGCACTAGCATCTCCTGGC -3'

Sequencing Primer
(F):5'- GACTGGCCTTGAGCTCAATC -3'
(R):5'- TGGCATCTTTTACCTCCTTATAGAG -3'
Posted On2016-06-15