Incidental Mutation 'R5050:Vmn2r51'
ID394592
Institutional Source Beutler Lab
Gene Symbol Vmn2r51
Ensembl Gene ENSMUSG00000058685
Gene Namevomeronasal 2, receptor 51
Synonyms
MMRRC Submission 042640-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R5050 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location10087198-10105659 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 10100422 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 230 (K230E)
Ref Sequence ENSEMBL: ENSMUSP00000092459 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094863]
Predicted Effect probably damaging
Transcript: ENSMUST00000094863
AA Change: K230E

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000092459
Gene: ENSMUSG00000058685
AA Change: K230E

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 469 2.4e-31 PFAM
Pfam:NCD3G 512 565 8.1e-21 PFAM
Pfam:7tm_3 598 833 2.7e-54 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 100% (69/69)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak A G 19: 9,012,458 probably benign Het
Ap3m1 A G 14: 21,044,775 I108T probably benign Het
Apobec1 T C 6: 122,591,102 M1V probably null Het
Aqr A T 2: 114,112,609 L1161* probably null Het
Aqr A T 2: 114,170,025 probably null Het
Arhgef37 A G 18: 61,504,331 I420T probably benign Het
Cacna1g C T 11: 94,459,715 E435K probably damaging Het
Card6 G T 15: 5,100,376 H513N probably benign Het
Ccdc158 A C 5: 92,666,879 F29L probably benign Het
Ccr6 T C 17: 8,256,104 L47S probably damaging Het
Cdc42bpa T A 1: 180,072,453 Y444* probably null Het
Cdh17 A G 4: 11,784,654 Y270C probably damaging Het
Cdh9 T C 15: 16,778,147 F16S probably benign Het
Cdkl1 T C 12: 69,757,240 K141R probably damaging Het
Chd4 T C 6: 125,107,480 Y692H probably damaging Het
Dhrs7 T A 12: 72,657,410 D104V probably damaging Het
Dhtkd1 A T 2: 5,917,689 L553Q probably benign Het
Dnah7a T G 1: 53,497,096 D2596A probably benign Het
Dync1li2 T C 8: 104,437,441 K151E probably damaging Het
Eno4 C T 19: 58,955,496 H297Y probably benign Het
Epg5 T A 18: 77,975,941 D976E possibly damaging Het
Fam160b1 T A 19: 57,383,170 F571L probably damaging Het
Gm1966 T C 7: 106,596,972 noncoding transcript Het
Gm4553 C A 7: 142,165,036 K218N unknown Het
Gm4788 T A 1: 139,736,840 I494F probably damaging Het
Gpld1 A T 13: 24,962,756 T234S probably benign Het
Gtpbp6 A T 5: 110,104,701 probably benign Het
Gucy2g T C 19: 55,240,935 E101G probably benign Het
Hira G A 16: 18,925,859 R442K possibly damaging Het
Hrh3 A G 2: 180,100,557 L394P probably damaging Het
Igkv1-110 T A 6: 68,271,192 F95Y probably damaging Het
Iqgap3 T G 3: 88,090,186 V223G probably damaging Het
Itpk1 T C 12: 102,704,810 T3A probably damaging Het
Jag1 A G 2: 137,085,154 V895A possibly damaging Het
Kazn G A 4: 142,118,203 probably benign Het
Large2 A T 2: 92,367,779 L282Q probably benign Het
Lgmn A G 12: 102,403,421 probably null Het
Lrp4 A T 2: 91,492,422 I1119F probably benign Het
Map3k19 T C 1: 127,823,562 H684R probably benign Het
Mier3 C T 13: 111,714,573 A367V possibly damaging Het
Mpdz A G 4: 81,295,448 V1579A probably benign Het
Mroh2b A T 15: 4,900,450 D6V possibly damaging Het
Myh7b A G 2: 155,631,750 I1568V probably benign Het
Olfr675 T A 7: 105,024,387 I198F probably damaging Het
Plch2 C T 4: 155,043,309 probably benign Het
Plek T C 11: 16,995,216 D38G probably damaging Het
Polr2f A G 15: 79,144,662 probably benign Het
Samsn1 A G 16: 75,888,757 S38P probably benign Het
Sf1 C T 19: 6,372,559 T248I probably damaging Het
Sgms2 C T 3: 131,330,356 V232M probably benign Het
Sharpin A T 15: 76,348,330 L160H probably damaging Het
Sympk C T 7: 19,036,042 R215C probably benign Het
Syn3 T C 10: 86,407,668 T136A probably benign Het
Tcam1 G A 11: 106,285,452 V335M possibly damaging Het
Tedc1 G T 12: 113,156,705 V56L possibly damaging Het
Tenm4 T C 7: 96,895,788 L2337P probably damaging Het
Ttn G A 2: 76,884,811 probably benign Het
Tysnd1 T A 10: 61,696,271 I234N probably damaging Het
Other mutations in Vmn2r51
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01398:Vmn2r51 APN 7 10102414 missense probably benign
IGL01574:Vmn2r51 APN 7 10102454 missense probably damaging 1.00
IGL01743:Vmn2r51 APN 7 10100227 missense probably damaging 0.98
IGL01820:Vmn2r51 APN 7 10105482 missense probably damaging 1.00
IGL02563:Vmn2r51 APN 7 10100316 missense probably benign 0.00
IGL02825:Vmn2r51 APN 7 10098119 splice site probably benign
IGL02834:Vmn2r51 APN 7 10098136 nonsense probably null
R0617:Vmn2r51 UTSW 7 10100469 missense possibly damaging 0.65
R0967:Vmn2r51 UTSW 7 10100085 missense probably damaging 0.97
R1465:Vmn2r51 UTSW 7 10100322 missense probably damaging 1.00
R1465:Vmn2r51 UTSW 7 10100322 missense probably damaging 1.00
R1559:Vmn2r51 UTSW 7 10102445 missense possibly damaging 0.58
R1559:Vmn2r51 UTSW 7 10102446 missense possibly damaging 0.87
R1598:Vmn2r51 UTSW 7 10105505 missense probably benign
R1754:Vmn2r51 UTSW 7 10099946 missense probably benign 0.04
R1836:Vmn2r51 UTSW 7 10098163 nonsense probably null
R1836:Vmn2r51 UTSW 7 10098164 nonsense probably null
R3151:Vmn2r51 UTSW 7 10100041 missense probably damaging 1.00
R4566:Vmn2r51 UTSW 7 10102414 missense probably benign
R4933:Vmn2r51 UTSW 7 10098320 missense probably damaging 1.00
R5004:Vmn2r51 UTSW 7 10088005 missense probably benign
R5510:Vmn2r51 UTSW 7 10102618 missense possibly damaging 0.95
R5559:Vmn2r51 UTSW 7 10092201 missense probably damaging 1.00
R6127:Vmn2r51 UTSW 7 10105631 missense probably damaging 1.00
R6154:Vmn2r51 UTSW 7 10087994 missense possibly damaging 0.74
R6304:Vmn2r51 UTSW 7 10098237 missense probably benign 0.00
R6370:Vmn2r51 UTSW 7 10098216 missense probably damaging 1.00
R6471:Vmn2r51 UTSW 7 10102583 missense possibly damaging 0.48
R6800:Vmn2r51 UTSW 7 10098264 missense probably damaging 0.99
R6883:Vmn2r51 UTSW 7 10100098 missense possibly damaging 0.75
R7191:Vmn2r51 UTSW 7 10100553 missense probably null 1.00
R7246:Vmn2r51 UTSW 7 10102501 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGTCCAACATTCTGAAGATCAAG -3'
(R):5'- ATGCACCTCACCTCATGCTG -3'

Sequencing Primer
(F):5'- CCAACATTCTGAAGATCAAGTCAATG -3'
(R):5'- GTAGCTCCTTATGCTTACCTATGGAC -3'
Posted On2016-06-15