Incidental Mutation 'R5050:Olfr675'
ID394595
Institutional Source Beutler Lab
Gene Symbol Olfr675
Ensembl Gene ENSMUSG00000096773
Gene Nameolfactory receptor 675
SynonymsGA_x6K02T2PBJ9-7653782-7652841, MOR32-9P
MMRRC Submission 042640-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.364) question?
Stock #R5050 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location105021370-105028460 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 105024387 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 198 (I198F)
Ref Sequence ENSEMBL: ENSMUSP00000149895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073102] [ENSMUST00000210113] [ENSMUST00000214318] [ENSMUST00000215899]
Predicted Effect probably damaging
Transcript: ENSMUST00000073102
AA Change: I194F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072847
Gene: ENSMUSG00000096773
AA Change: I194F

DomainStartEndE-ValueType
Pfam:7tm_4 33 311 5e-118 PFAM
Pfam:7TM_GPCR_Srsx 37 308 1.9e-6 PFAM
Pfam:7tm_1 43 293 2.6e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000210113
AA Change: I198F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000214318
AA Change: I198F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000215899
AA Change: I198F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.4212 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak A G 19: 9,012,458 probably benign Het
Ap3m1 A G 14: 21,044,775 I108T probably benign Het
Apobec1 T C 6: 122,591,102 M1V probably null Het
Aqr A T 2: 114,112,609 L1161* probably null Het
Aqr A T 2: 114,170,025 probably null Het
Arhgef37 A G 18: 61,504,331 I420T probably benign Het
Cacna1g C T 11: 94,459,715 E435K probably damaging Het
Card6 G T 15: 5,100,376 H513N probably benign Het
Ccdc158 A C 5: 92,666,879 F29L probably benign Het
Ccr6 T C 17: 8,256,104 L47S probably damaging Het
Cdc42bpa T A 1: 180,072,453 Y444* probably null Het
Cdh17 A G 4: 11,784,654 Y270C probably damaging Het
Cdh9 T C 15: 16,778,147 F16S probably benign Het
Cdkl1 T C 12: 69,757,240 K141R probably damaging Het
Chd4 T C 6: 125,107,480 Y692H probably damaging Het
Dhrs7 T A 12: 72,657,410 D104V probably damaging Het
Dhtkd1 A T 2: 5,917,689 L553Q probably benign Het
Dnah7a T G 1: 53,497,096 D2596A probably benign Het
Dync1li2 T C 8: 104,437,441 K151E probably damaging Het
Eno4 C T 19: 58,955,496 H297Y probably benign Het
Epg5 T A 18: 77,975,941 D976E possibly damaging Het
Fam160b1 T A 19: 57,383,170 F571L probably damaging Het
Gm1966 T C 7: 106,596,972 noncoding transcript Het
Gm4553 C A 7: 142,165,036 K218N unknown Het
Gm4788 T A 1: 139,736,840 I494F probably damaging Het
Gpld1 A T 13: 24,962,756 T234S probably benign Het
Gtpbp6 A T 5: 110,104,701 probably benign Het
Gucy2g T C 19: 55,240,935 E101G probably benign Het
Hira G A 16: 18,925,859 R442K possibly damaging Het
Hrh3 A G 2: 180,100,557 L394P probably damaging Het
Igkv1-110 T A 6: 68,271,192 F95Y probably damaging Het
Iqgap3 T G 3: 88,090,186 V223G probably damaging Het
Itpk1 T C 12: 102,704,810 T3A probably damaging Het
Jag1 A G 2: 137,085,154 V895A possibly damaging Het
Kazn G A 4: 142,118,203 probably benign Het
Large2 A T 2: 92,367,779 L282Q probably benign Het
Lgmn A G 12: 102,403,421 probably null Het
Lrp4 A T 2: 91,492,422 I1119F probably benign Het
Map3k19 T C 1: 127,823,562 H684R probably benign Het
Mier3 C T 13: 111,714,573 A367V possibly damaging Het
Mpdz A G 4: 81,295,448 V1579A probably benign Het
Mroh2b A T 15: 4,900,450 D6V possibly damaging Het
Myh7b A G 2: 155,631,750 I1568V probably benign Het
Plch2 C T 4: 155,043,309 probably benign Het
Plek T C 11: 16,995,216 D38G probably damaging Het
Polr2f A G 15: 79,144,662 probably benign Het
Samsn1 A G 16: 75,888,757 S38P probably benign Het
Sf1 C T 19: 6,372,559 T248I probably damaging Het
Sgms2 C T 3: 131,330,356 V232M probably benign Het
Sharpin A T 15: 76,348,330 L160H probably damaging Het
Sympk C T 7: 19,036,042 R215C probably benign Het
Syn3 T C 10: 86,407,668 T136A probably benign Het
Tcam1 G A 11: 106,285,452 V335M possibly damaging Het
Tedc1 G T 12: 113,156,705 V56L possibly damaging Het
Tenm4 T C 7: 96,895,788 L2337P probably damaging Het
Ttn G A 2: 76,884,811 probably benign Het
Tysnd1 T A 10: 61,696,271 I234N probably damaging Het
Vmn2r51 T C 7: 10,100,422 K230E probably damaging Het
Other mutations in Olfr675
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02639:Olfr675 APN 7 105024222 missense probably damaging 1.00
IGL02944:Olfr675 APN 7 105024923 missense probably damaging 1.00
R1182:Olfr675 UTSW 7 105024078 missense probably damaging 1.00
R1412:Olfr675 UTSW 7 105024195 missense probably damaging 1.00
R1528:Olfr675 UTSW 7 105024764 missense probably damaging 1.00
R1555:Olfr675 UTSW 7 105024522 missense probably benign 0.00
R1589:Olfr675 UTSW 7 105024560 missense probably benign
R1778:Olfr675 UTSW 7 105024163 missense probably benign 0.03
R3690:Olfr675 UTSW 7 105024695 missense probably damaging 0.99
R3848:Olfr675 UTSW 7 105024332 missense probably damaging 0.99
R4784:Olfr675 UTSW 7 105024530 missense probably damaging 0.97
R5074:Olfr675 UTSW 7 105024053 missense probably benign
R5499:Olfr675 UTSW 7 105024977 start codon destroyed probably null 0.06
R5586:Olfr675 UTSW 7 105024221 missense probably damaging 1.00
R7244:Olfr675 UTSW 7 105024941 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTGGCCAAAACGATGTGTCAAG -3'
(R):5'- CGTTGCCATTTGTAAGCCCC -3'

Sequencing Primer
(F):5'- CCAAAACGATGTGTCAAGAAGGAG -3'
(R):5'- GCCATTTGTAAGCCCCTTCAATATAC -3'
Posted On2016-06-15