Incidental Mutation 'R5050:Ap3m1'
ID394610
Institutional Source Beutler Lab
Gene Symbol Ap3m1
Ensembl Gene ENSMUSG00000021824
Gene Nameadaptor-related protein complex 3, mu 1 subunit
SynonymsC78982, 1200013D09Rik
MMRRC Submission 042640-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R5050 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location21031442-21052508 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 21044775 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 108 (I108T)
Ref Sequence ENSEMBL: ENSMUSP00000117346 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022371] [ENSMUST00000126536] [ENSMUST00000130291] [ENSMUST00000130370] [ENSMUST00000154460] [ENSMUST00000224016]
Predicted Effect probably benign
Transcript: ENSMUST00000022371
SMART Domains Protein: ENSMUSP00000022371
Gene: ENSMUSG00000021824

DomainStartEndE-ValueType
SCOP:d1gw5m2 1 96 1e-23 SMART
Pfam:Adap_comp_sub 111 364 9.1e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126536
SMART Domains Protein: ENSMUSP00000116046
Gene: ENSMUSG00000021824

DomainStartEndE-ValueType
SCOP:d1gw5m2 1 91 9e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130291
AA Change: I108T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000118259
Gene: ENSMUSG00000021824
AA Change: I108T

DomainStartEndE-ValueType
Pfam:Clat_adaptor_s 1 138 9e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130370
AA Change: I108T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000115157
Gene: ENSMUSG00000021824
AA Change: I108T

DomainStartEndE-ValueType
Pfam:Clat_adaptor_s 1 138 1.6e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148886
Predicted Effect probably benign
Transcript: ENSMUST00000154460
AA Change: I108T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000117346
Gene: ENSMUSG00000021824
AA Change: I108T

DomainStartEndE-ValueType
Pfam:Clat_adaptor_s 1 136 1.8e-8 PFAM
Pfam:Adap_comp_sub 165 418 1e-77 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156716
Predicted Effect probably benign
Transcript: ENSMUST00000224016
Meta Mutation Damage Score 0.0617 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the medium subunit of AP-3, which is an adaptor-related protein complex associated with the Golgi region as well as more peripheral intracellular structures. AP-3 facilitates the budding of vesicles from the Golgi membrane, and it may directly function in protein sorting to the endosomal/lysosomal system. AP-3 is a heterotetrameric protein complex composed of two large subunits (delta and beta3), a medium subunit (mu3), and a small subunit (sigma 3). Mutations in one of the large subunits of AP-3 have been associated with the Hermansky-Pudlak syndrome, a genetic disorder characterized by defective lysosome-related organelles. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak A G 19: 9,012,458 probably benign Het
Apobec1 T C 6: 122,591,102 M1V probably null Het
Aqr A T 2: 114,112,609 L1161* probably null Het
Aqr A T 2: 114,170,025 probably null Het
Arhgef37 A G 18: 61,504,331 I420T probably benign Het
Cacna1g C T 11: 94,459,715 E435K probably damaging Het
Card6 G T 15: 5,100,376 H513N probably benign Het
Ccdc158 A C 5: 92,666,879 F29L probably benign Het
Ccr6 T C 17: 8,256,104 L47S probably damaging Het
Cdc42bpa T A 1: 180,072,453 Y444* probably null Het
Cdh17 A G 4: 11,784,654 Y270C probably damaging Het
Cdh9 T C 15: 16,778,147 F16S probably benign Het
Cdkl1 T C 12: 69,757,240 K141R probably damaging Het
Chd4 T C 6: 125,107,480 Y692H probably damaging Het
Dhrs7 T A 12: 72,657,410 D104V probably damaging Het
Dhtkd1 A T 2: 5,917,689 L553Q probably benign Het
Dnah7a T G 1: 53,497,096 D2596A probably benign Het
Dync1li2 T C 8: 104,437,441 K151E probably damaging Het
Eno4 C T 19: 58,955,496 H297Y probably benign Het
Epg5 T A 18: 77,975,941 D976E possibly damaging Het
Fam160b1 T A 19: 57,383,170 F571L probably damaging Het
Gm1966 T C 7: 106,596,972 noncoding transcript Het
Gm4553 C A 7: 142,165,036 K218N unknown Het
Gm4788 T A 1: 139,736,840 I494F probably damaging Het
Gpld1 A T 13: 24,962,756 T234S probably benign Het
Gtpbp6 A T 5: 110,104,701 probably benign Het
Gucy2g T C 19: 55,240,935 E101G probably benign Het
Hira G A 16: 18,925,859 R442K possibly damaging Het
Hrh3 A G 2: 180,100,557 L394P probably damaging Het
Igkv1-110 T A 6: 68,271,192 F95Y probably damaging Het
Iqgap3 T G 3: 88,090,186 V223G probably damaging Het
Itpk1 T C 12: 102,704,810 T3A probably damaging Het
Jag1 A G 2: 137,085,154 V895A possibly damaging Het
Kazn G A 4: 142,118,203 probably benign Het
Large2 A T 2: 92,367,779 L282Q probably benign Het
Lgmn A G 12: 102,403,421 probably null Het
Lrp4 A T 2: 91,492,422 I1119F probably benign Het
Map3k19 T C 1: 127,823,562 H684R probably benign Het
Mier3 C T 13: 111,714,573 A367V possibly damaging Het
Mpdz A G 4: 81,295,448 V1579A probably benign Het
Mroh2b A T 15: 4,900,450 D6V possibly damaging Het
Myh7b A G 2: 155,631,750 I1568V probably benign Het
Olfr675 T A 7: 105,024,387 I198F probably damaging Het
Plch2 C T 4: 155,043,309 probably benign Het
Plek T C 11: 16,995,216 D38G probably damaging Het
Polr2f A G 15: 79,144,662 probably benign Het
Samsn1 A G 16: 75,888,757 S38P probably benign Het
Sf1 C T 19: 6,372,559 T248I probably damaging Het
Sgms2 C T 3: 131,330,356 V232M probably benign Het
Sharpin A T 15: 76,348,330 L160H probably damaging Het
Sympk C T 7: 19,036,042 R215C probably benign Het
Syn3 T C 10: 86,407,668 T136A probably benign Het
Tcam1 G A 11: 106,285,452 V335M possibly damaging Het
Tedc1 G T 12: 113,156,705 V56L possibly damaging Het
Tenm4 T C 7: 96,895,788 L2337P probably damaging Het
Ttn G A 2: 76,884,811 probably benign Het
Tysnd1 T A 10: 61,696,271 I234N probably damaging Het
Vmn2r51 T C 7: 10,100,422 K230E probably damaging Het
Other mutations in Ap3m1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02628:Ap3m1 APN 14 21045520 nonsense probably null
IGL02815:Ap3m1 APN 14 21036682 missense probably damaging 1.00
R0268:Ap3m1 UTSW 14 21037102 splice site probably benign
R1780:Ap3m1 UTSW 14 21041070 missense probably benign 0.20
R1961:Ap3m1 UTSW 14 21041015 missense probably damaging 1.00
R2029:Ap3m1 UTSW 14 21039149 missense possibly damaging 0.94
R3903:Ap3m1 UTSW 14 21036664 missense probably null 1.00
R4837:Ap3m1 UTSW 14 21037157 missense probably damaging 1.00
R4952:Ap3m1 UTSW 14 21040066 missense probably benign 0.00
R5741:Ap3m1 UTSW 14 21045720 missense possibly damaging 0.95
R6761:Ap3m1 UTSW 14 21038028 missense probably benign
R7394:Ap3m1 UTSW 14 21038079 missense probably benign 0.00
R7487:Ap3m1 UTSW 14 21038039 missense probably benign
R7640:Ap3m1 UTSW 14 21038175 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CTGTCATATGAGCAAAATGAGCTG -3'
(R):5'- GCAGATTGATGTCTCAGTACTTTC -3'

Sequencing Primer
(F):5'- GGATCAGTTCCTAGCAGT -3'
(R):5'- GATGTCTCAGTACTTTCTGTCATG -3'
Posted On2016-06-15