Incidental Mutation 'R5050:Polr2f'
ID394614
Institutional Source Beutler Lab
Gene Symbol Polr2f
Ensembl Gene ENSMUSG00000033020
Gene Namepolymerase (RNA) II (DNA directed) polypeptide F
SynonymsRNA Pol II, 1810060D16Rik
MMRRC Submission 042640-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5050 (G1)
Quality Score210
Status Validated
Chromosome15
Chromosomal Location79141009-79151774 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 79144662 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140347 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040077] [ENSMUST00000169604] [ENSMUST00000186053] [ENSMUST00000186459] [ENSMUST00000187550] [ENSMUST00000188562] [ENSMUST00000189761] [ENSMUST00000190509] [ENSMUST00000190730] [ENSMUST00000190959] [ENSMUST00000229973] [ENSMUST00000230271]
Predicted Effect unknown
Transcript: ENSMUST00000040077
AA Change: E30G
SMART Domains Protein: ENSMUSP00000043566
Gene: ENSMUSG00000033020
AA Change: E30G

DomainStartEndE-ValueType
low complexity region 3 37 N/A INTRINSIC
Pfam:RNA_pol_Rpb6 51 104 2.7e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169604
SMART Domains Protein: ENSMUSP00000129244
Gene: ENSMUSG00000033029

DomainStartEndE-ValueType
Pfam:UPF0193 4 213 3.2e-92 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186053
SMART Domains Protein: ENSMUSP00000140261
Gene: ENSMUSG00000033029

DomainStartEndE-ValueType
Pfam:UPF0193 1 58 3.5e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186459
SMART Domains Protein: ENSMUSP00000139974
Gene: ENSMUSG00000033029

DomainStartEndE-ValueType
Pfam:UPF0193 1 54 5e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000187550
SMART Domains Protein: ENSMUSP00000140978
Gene: ENSMUSG00000033029

DomainStartEndE-ValueType
Pfam:UPF0193 1 57 2.1e-22 PFAM
Pfam:UPF0193 54 155 8.3e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188562
Predicted Effect probably benign
Transcript: ENSMUST00000189761
SMART Domains Protein: ENSMUSP00000139736
Gene: ENSMUSG00000033029

DomainStartEndE-ValueType
Pfam:UPF0193 1 39 4.9e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190400
Predicted Effect probably benign
Transcript: ENSMUST00000190509
SMART Domains Protein: ENSMUSP00000140611
Gene: ENSMUSG00000033029

DomainStartEndE-ValueType
Pfam:UPF0193 33 195 4.4e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190730
SMART Domains Protein: ENSMUSP00000139884
Gene: ENSMUSG00000033029

DomainStartEndE-ValueType
Pfam:UPF0193 1 57 2.1e-22 PFAM
Pfam:UPF0193 54 155 8.3e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190959
SMART Domains Protein: ENSMUSP00000140347
Gene: ENSMUSG00000033029

DomainStartEndE-ValueType
Pfam:UPF0193 1 216 1.5e-75 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000229973
AA Change: E30G
Predicted Effect unknown
Transcript: ENSMUST00000230271
AA Change: E30G
Meta Mutation Damage Score 0.0861 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the sixth largest subunit of RNA polymerase II, the polymerase responsible for synthesizing messenger RNA in eukaryotes. In yeast, this polymerase subunit, in combination with at least two other subunits, forms a structure that stabilizes the transcribing polymerase on the DNA template. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak A G 19: 9,012,458 probably benign Het
Ap3m1 A G 14: 21,044,775 I108T probably benign Het
Apobec1 T C 6: 122,591,102 M1V probably null Het
Aqr A T 2: 114,112,609 L1161* probably null Het
Aqr A T 2: 114,170,025 probably null Het
Arhgef37 A G 18: 61,504,331 I420T probably benign Het
Cacna1g C T 11: 94,459,715 E435K probably damaging Het
Card6 G T 15: 5,100,376 H513N probably benign Het
Ccdc158 A C 5: 92,666,879 F29L probably benign Het
Ccr6 T C 17: 8,256,104 L47S probably damaging Het
Cdc42bpa T A 1: 180,072,453 Y444* probably null Het
Cdh17 A G 4: 11,784,654 Y270C probably damaging Het
Cdh9 T C 15: 16,778,147 F16S probably benign Het
Cdkl1 T C 12: 69,757,240 K141R probably damaging Het
Chd4 T C 6: 125,107,480 Y692H probably damaging Het
Dhrs7 T A 12: 72,657,410 D104V probably damaging Het
Dhtkd1 A T 2: 5,917,689 L553Q probably benign Het
Dnah7a T G 1: 53,497,096 D2596A probably benign Het
Dync1li2 T C 8: 104,437,441 K151E probably damaging Het
Eno4 C T 19: 58,955,496 H297Y probably benign Het
Epg5 T A 18: 77,975,941 D976E possibly damaging Het
Fam160b1 T A 19: 57,383,170 F571L probably damaging Het
Gm1966 T C 7: 106,596,972 noncoding transcript Het
Gm4553 C A 7: 142,165,036 K218N unknown Het
Gm4788 T A 1: 139,736,840 I494F probably damaging Het
Gpld1 A T 13: 24,962,756 T234S probably benign Het
Gtpbp6 A T 5: 110,104,701 probably benign Het
Gucy2g T C 19: 55,240,935 E101G probably benign Het
Hira G A 16: 18,925,859 R442K possibly damaging Het
Hrh3 A G 2: 180,100,557 L394P probably damaging Het
Igkv1-110 T A 6: 68,271,192 F95Y probably damaging Het
Iqgap3 T G 3: 88,090,186 V223G probably damaging Het
Itpk1 T C 12: 102,704,810 T3A probably damaging Het
Jag1 A G 2: 137,085,154 V895A possibly damaging Het
Kazn G A 4: 142,118,203 probably benign Het
Large2 A T 2: 92,367,779 L282Q probably benign Het
Lgmn A G 12: 102,403,421 probably null Het
Lrp4 A T 2: 91,492,422 I1119F probably benign Het
Map3k19 T C 1: 127,823,562 H684R probably benign Het
Mier3 C T 13: 111,714,573 A367V possibly damaging Het
Mpdz A G 4: 81,295,448 V1579A probably benign Het
Mroh2b A T 15: 4,900,450 D6V possibly damaging Het
Myh7b A G 2: 155,631,750 I1568V probably benign Het
Olfr675 T A 7: 105,024,387 I198F probably damaging Het
Plch2 C T 4: 155,043,309 probably benign Het
Plek T C 11: 16,995,216 D38G probably damaging Het
Samsn1 A G 16: 75,888,757 S38P probably benign Het
Sf1 C T 19: 6,372,559 T248I probably damaging Het
Sgms2 C T 3: 131,330,356 V232M probably benign Het
Sharpin A T 15: 76,348,330 L160H probably damaging Het
Sympk C T 7: 19,036,042 R215C probably benign Het
Syn3 T C 10: 86,407,668 T136A probably benign Het
Tcam1 G A 11: 106,285,452 V335M possibly damaging Het
Tedc1 G T 12: 113,156,705 V56L possibly damaging Het
Tenm4 T C 7: 96,895,788 L2337P probably damaging Het
Ttn G A 2: 76,884,811 probably benign Het
Tysnd1 T A 10: 61,696,271 I234N probably damaging Het
Vmn2r51 T C 7: 10,100,422 K230E probably damaging Het
Other mutations in Polr2f
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01013:Polr2f APN 15 79146129 missense probably damaging 1.00
R1727:Polr2f UTSW 15 79144605 unclassified probably benign
R3120:Polr2f UTSW 15 79144588 splice site probably null
R4724:Polr2f UTSW 15 79146069 missense probably benign 0.01
R5139:Polr2f UTSW 15 79151658 missense possibly damaging 0.53
R5768:Polr2f UTSW 15 79151645 missense probably damaging 1.00
R5817:Polr2f UTSW 15 79151669 missense probably damaging 0.98
R6313:Polr2f UTSW 15 79151373 missense probably damaging 1.00
R7494:Polr2f UTSW 15 79144665 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CCTAGCAAACTGTGGGGACA -3'
(R):5'- ACCATACATAAGACGACACGATT -3'

Sequencing Primer
(F):5'- ACAGAGTGACCCTCCAGAGTTTG -3'
(R):5'- CGATTATCCCAAGACCTAGTTGAG -3'
Posted On2016-06-15