Incidental Mutation 'R5050:Samsn1'
ID394616
Institutional Source Beutler Lab
Gene Symbol Samsn1
Ensembl Gene ENSMUSG00000022876
Gene NameSAM domain, SH3 domain and nuclear localization signals, 1
Synonyms4930571B16Rik, Hacs1
MMRRC Submission 042640-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5050 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location75858793-76022281 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 75888757 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 38 (S38P)
Ref Sequence ENSEMBL: ENSMUSP00000109877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114239] [ENSMUST00000114240]
PDB Structure
Solution structure of the Sterile Alpha Motif (SAM) domain of mouse SAMSN1 [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000114239
AA Change: S38P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000109877
Gene: ENSMUSG00000022876
AA Change: S38P

DomainStartEndE-ValueType
Pfam:SLY 17 164 4.7e-57 PFAM
SH3 166 223 8.78e-4 SMART
SAM 238 305 7.6e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000114240
SMART Domains Protein: ENSMUSP00000109878
Gene: ENSMUSG00000022876

DomainStartEndE-ValueType
low complexity region 69 80 N/A INTRINSIC
Pfam:SLY 146 293 1.1e-55 PFAM
SH3 295 352 8.78e-4 SMART
SAM 367 434 7.6e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139691
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147447
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150248
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226794
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SAMSN1 is a member of a novel gene family of putative adaptors and scaffold proteins containing SH3 and SAM (sterile alpha motif) domains (Claudio et al., 2001 [PubMed 11536050]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit enhanced adaptive immunity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak A G 19: 9,012,458 probably benign Het
Ap3m1 A G 14: 21,044,775 I108T probably benign Het
Apobec1 T C 6: 122,591,102 M1V probably null Het
Aqr A T 2: 114,112,609 L1161* probably null Het
Aqr A T 2: 114,170,025 probably null Het
Arhgef37 A G 18: 61,504,331 I420T probably benign Het
Cacna1g C T 11: 94,459,715 E435K probably damaging Het
Card6 G T 15: 5,100,376 H513N probably benign Het
Ccdc158 A C 5: 92,666,879 F29L probably benign Het
Ccr6 T C 17: 8,256,104 L47S probably damaging Het
Cdc42bpa T A 1: 180,072,453 Y444* probably null Het
Cdh17 A G 4: 11,784,654 Y270C probably damaging Het
Cdh9 T C 15: 16,778,147 F16S probably benign Het
Cdkl1 T C 12: 69,757,240 K141R probably damaging Het
Chd4 T C 6: 125,107,480 Y692H probably damaging Het
Dhrs7 T A 12: 72,657,410 D104V probably damaging Het
Dhtkd1 A T 2: 5,917,689 L553Q probably benign Het
Dnah7a T G 1: 53,497,096 D2596A probably benign Het
Dync1li2 T C 8: 104,437,441 K151E probably damaging Het
Eno4 C T 19: 58,955,496 H297Y probably benign Het
Epg5 T A 18: 77,975,941 D976E possibly damaging Het
Fam160b1 T A 19: 57,383,170 F571L probably damaging Het
Gm1966 T C 7: 106,596,972 noncoding transcript Het
Gm4553 C A 7: 142,165,036 K218N unknown Het
Gm4788 T A 1: 139,736,840 I494F probably damaging Het
Gpld1 A T 13: 24,962,756 T234S probably benign Het
Gtpbp6 A T 5: 110,104,701 probably benign Het
Gucy2g T C 19: 55,240,935 E101G probably benign Het
Hira G A 16: 18,925,859 R442K possibly damaging Het
Hrh3 A G 2: 180,100,557 L394P probably damaging Het
Igkv1-110 T A 6: 68,271,192 F95Y probably damaging Het
Iqgap3 T G 3: 88,090,186 V223G probably damaging Het
Itpk1 T C 12: 102,704,810 T3A probably damaging Het
Jag1 A G 2: 137,085,154 V895A possibly damaging Het
Kazn G A 4: 142,118,203 probably benign Het
Large2 A T 2: 92,367,779 L282Q probably benign Het
Lgmn A G 12: 102,403,421 probably null Het
Lrp4 A T 2: 91,492,422 I1119F probably benign Het
Map3k19 T C 1: 127,823,562 H684R probably benign Het
Mier3 C T 13: 111,714,573 A367V possibly damaging Het
Mpdz A G 4: 81,295,448 V1579A probably benign Het
Mroh2b A T 15: 4,900,450 D6V possibly damaging Het
Myh7b A G 2: 155,631,750 I1568V probably benign Het
Olfr675 T A 7: 105,024,387 I198F probably damaging Het
Plch2 C T 4: 155,043,309 probably benign Het
Plek T C 11: 16,995,216 D38G probably damaging Het
Polr2f A G 15: 79,144,662 probably benign Het
Sf1 C T 19: 6,372,559 T248I probably damaging Het
Sgms2 C T 3: 131,330,356 V232M probably benign Het
Sharpin A T 15: 76,348,330 L160H probably damaging Het
Sympk C T 7: 19,036,042 R215C probably benign Het
Syn3 T C 10: 86,407,668 T136A probably benign Het
Tcam1 G A 11: 106,285,452 V335M possibly damaging Het
Tedc1 G T 12: 113,156,705 V56L possibly damaging Het
Tenm4 T C 7: 96,895,788 L2337P probably damaging Het
Ttn G A 2: 76,884,811 probably benign Het
Tysnd1 T A 10: 61,696,271 I234N probably damaging Het
Vmn2r51 T C 7: 10,100,422 K230E probably damaging Het
Other mutations in Samsn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Samsn1 APN 16 75909120 splice site probably benign
IGL02220:Samsn1 APN 16 75883875 critical splice donor site probably null
R0455:Samsn1 UTSW 16 75945225 unclassified noncoding transcript
R1136:Samsn1 UTSW 16 75873520 missense probably null 0.00
R1140:Samsn1 UTSW 16 75888742 missense possibly damaging 0.73
R1180:Samsn1 UTSW 16 75873648 missense probably damaging 1.00
R1772:Samsn1 UTSW 16 75870775 missense probably benign 0.01
R1968:Samsn1 UTSW 16 75945573 exon noncoding transcript
R4035:Samsn1 UTSW 16 75909185 start codon destroyed probably null 0.99
R4372:Samsn1 UTSW 16 75859456 missense possibly damaging 0.80
R4725:Samsn1 UTSW 16 75945329 unclassified noncoding transcript
R4779:Samsn1 UTSW 16 75947289 exon noncoding transcript
R4795:Samsn1 UTSW 16 75883845 intron probably benign
R4899:Samsn1 UTSW 16 75879103 missense probably damaging 1.00
R4905:Samsn1 UTSW 16 75876465 missense possibly damaging 0.94
R5789:Samsn1 UTSW 16 75876448 missense probably damaging 1.00
R6005:Samsn1 UTSW 16 75873514 missense probably benign 0.03
R6190:Samsn1 UTSW 16 75870915 missense probably damaging 1.00
R6218:Samsn1 UTSW 16 75945274 unclassified noncoding transcript
R6630:Samsn1 UTSW 16 75879204 missense probably benign 0.00
R7086:Samsn1 UTSW 16 75870906 missense probably benign 0.00
R8289:Samsn1 UTSW 16 75888796 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCCCAATGTGGTACTAGGC -3'
(R):5'- ATATCCAATGGCTTTTGATGGCTGG -3'

Sequencing Primer
(F):5'- GTGGTACTAGGCCCTAAATATTGTCC -3'
(R):5'- GCTGGAAGGACTTTTAATAGTTTTCC -3'
Posted On2016-06-15