Incidental Mutation 'R5051:Cntn6'
ID 394643
Institutional Source Beutler Lab
Gene Symbol Cntn6
Ensembl Gene ENSMUSG00000030092
Gene Name contactin 6
Synonyms NB-3
MMRRC Submission 042641-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.145) question?
Stock # R5051 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 104492790-104863406 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 104772597 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 259 (I259N)
Ref Sequence ENSEMBL: ENSMUSP00000124714 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089215] [ENSMUST00000161070] [ENSMUST00000162872]
AlphaFold Q9JMB8
Predicted Effect probably damaging
Transcript: ENSMUST00000089215
AA Change: I331N

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000086623
Gene: ENSMUSG00000030092
AA Change: I331N

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGc2 41 107 5.24e-7 SMART
IG 129 217 2.28e-7 SMART
IGc2 240 304 4e-12 SMART
IGc2 330 393 4.52e-11 SMART
IGc2 422 486 5.48e-10 SMART
IGc2 512 584 1.44e-4 SMART
FN3 598 684 2.17e-11 SMART
FN3 701 787 8.62e0 SMART
FN3 803 888 9.92e-6 SMART
FN3 903 983 8.17e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000161070
AA Change: I259N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124714
Gene: ENSMUSG00000030092
AA Change: I259N

DomainStartEndE-ValueType
SCOP:d1cs6a4 4 40 5e-4 SMART
IG 57 145 2.28e-7 SMART
IGc2 168 232 4e-12 SMART
IGc2 258 321 4.52e-11 SMART
IGc2 350 414 5.48e-10 SMART
IGc2 440 512 1.44e-4 SMART
FN3 526 612 2.17e-11 SMART
FN3 629 715 8.62e0 SMART
FN3 731 816 9.92e-6 SMART
FN3 831 911 8.17e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000162872
AA Change: I331N

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124025
Gene: ENSMUSG00000030092
AA Change: I331N

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGc2 41 107 5.24e-7 SMART
IG 129 217 2.28e-7 SMART
IGc2 240 304 4e-12 SMART
IGc2 330 393 4.52e-11 SMART
IGc2 422 486 5.48e-10 SMART
IGc2 512 584 1.44e-4 SMART
FN3 598 684 2.17e-11 SMART
FN3 701 787 8.62e0 SMART
FN3 803 888 9.92e-6 SMART
FN3 903 983 8.17e0 SMART
Meta Mutation Damage Score 0.3557 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.3%
  • 10x: 95.9%
  • 20x: 90.6%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily. It is a glycosylphosphatidylinositol (GPI)-anchored neuronal membrane protein that functions as a cell adhesion molecule. It may play a role in the formation of axon connections in the developing nervous system. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for disruption of this gene display impaired coordination without any obvious morphological of physiological abnormalities in the brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T A 1: 105,691,986 N313K possibly damaging Het
5730522E02Rik G A 11: 25,768,990 T51I unknown Het
Alms1 C T 6: 85,627,934 Q2189* probably null Het
Ank1 A T 8: 23,119,381 D1363V probably damaging Het
Ap3d1 T G 10: 80,719,199 T431P probably damaging Het
Arnt A G 3: 95,470,337 T125A probably benign Het
Atp10a TGTCCGTC TGTC 7: 58,740,246 probably null Het
Bscl2 A T 19: 8,845,279 R195* probably null Het
Ccdc146 C T 5: 21,303,083 V656I possibly damaging Het
Ccr4 T C 9: 114,492,646 Y117C probably damaging Het
Cd55 T A 1: 130,448,348 D355V probably damaging Het
Cspg4 A G 9: 56,885,736 I252V possibly damaging Het
Dmbt1 T C 7: 131,094,742 V895A probably benign Het
Ect2 A G 3: 27,102,486 V775A probably benign Het
Gm14486 T C 2: 30,658,877 noncoding transcript Het
Grin2b T C 6: 135,779,395 N444S possibly damaging Het
Heatr5b T C 17: 78,795,274 D1225G probably damaging Het
Il1rl2 G A 1: 40,343,094 V189I probably benign Het
Kif1a G A 1: 93,076,154 probably null Het
Ltbr T A 6: 125,312,770 T154S probably damaging Het
Mrgpra6 C T 7: 47,185,942 V244I probably benign Het
Myo15 G A 11: 60,487,425 probably null Het
Ndufs1 A G 1: 63,164,947 probably null Het
Nectin3 A T 16: 46,448,550 N496K possibly damaging Het
Nkd2 A G 13: 73,825,076 V147A probably benign Het
Nlrp3 G C 11: 59,566,199 R1013P probably benign Het
Olfr1280 T A 2: 111,316,254 Y258* probably null Het
Olfr1423 C A 19: 12,035,924 V273F possibly damaging Het
Pdk2 T C 11: 95,028,772 S263G probably benign Het
Pla2g4e T A 2: 120,174,304 I520F probably damaging Het
Plat A G 8: 22,773,672 T196A probably benign Het
Podn T A 4: 108,014,846 D400V probably benign Het
Poteg T C 8: 27,453,329 V147A possibly damaging Het
Prkar2a A G 9: 108,745,491 N315D probably benign Het
Rac2 A G 15: 78,564,934 I13T possibly damaging Het
Rangap1 A C 15: 81,710,463 D388E probably benign Het
Sp140 T A 1: 85,610,828 D95E possibly damaging Het
Supv3l1 A C 10: 62,443,417 I240S probably damaging Het
Sympk C T 7: 19,036,042 R215C probably benign Het
Tead4 A C 6: 128,294,299 probably benign Het
Tex10 G A 4: 48,460,019 A444V possibly damaging Het
Tgds A T 14: 118,128,227 I73K probably damaging Het
Tmem117 C A 15: 94,714,913 T110K probably damaging Het
Trim30a T A 7: 104,411,706 probably benign Het
Unc80 C T 1: 66,509,477 T636I probably damaging Het
Wisp3 A G 10: 39,155,156 F124L probably benign Het
Ybey G A 10: 76,468,339 R10W probably damaging Het
Zap70 A G 1: 36,781,451 I576V probably benign Het
Zfp64 T C 2: 168,926,384 D436G probably damaging Het
Other mutations in Cntn6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00547:Cntn6 APN 6 104650400 missense probably damaging 0.99
IGL01331:Cntn6 APN 6 104774523 missense probably damaging 1.00
IGL01619:Cntn6 APN 6 104728374 splice site probably benign
IGL02028:Cntn6 APN 6 104859426 missense probably damaging 0.99
IGL02420:Cntn6 APN 6 104846142 critical splice donor site probably null
IGL02557:Cntn6 APN 6 104774535 missense probably damaging 1.00
IGL03000:Cntn6 APN 6 104804386 missense probably damaging 1.00
IGL03367:Cntn6 APN 6 104804338 missense probably damaging 1.00
IGL03383:Cntn6 APN 6 104776457 splice site probably benign
PIT4366001:Cntn6 UTSW 6 104832537 missense probably benign 0.05
R0490:Cntn6 UTSW 6 104833918 missense possibly damaging 0.91
R0583:Cntn6 UTSW 6 104776314 missense possibly damaging 0.79
R0636:Cntn6 UTSW 6 104863148 missense probably benign 0.00
R0654:Cntn6 UTSW 6 104776428 missense probably benign 0.00
R0960:Cntn6 UTSW 6 104774480 missense probably benign 0.01
R1241:Cntn6 UTSW 6 104832509 missense probably damaging 1.00
R1385:Cntn6 UTSW 6 104861900 missense probably benign 0.07
R1401:Cntn6 UTSW 6 104804398 missense possibly damaging 0.65
R1478:Cntn6 UTSW 6 104776428 missense probably benign 0.00
R1542:Cntn6 UTSW 6 104848100 missense probably damaging 1.00
R1593:Cntn6 UTSW 6 104832580 missense possibly damaging 0.58
R1840:Cntn6 UTSW 6 104774480 missense probably damaging 1.00
R2066:Cntn6 UTSW 6 104861822 nonsense probably null
R2097:Cntn6 UTSW 6 104861949 missense probably damaging 0.99
R2289:Cntn6 UTSW 6 104569028 start gained probably benign
R2429:Cntn6 UTSW 6 104650565 missense possibly damaging 0.96
R2967:Cntn6 UTSW 6 104726237 missense probably benign 0.04
R4009:Cntn6 UTSW 6 104833822 missense probably damaging 0.98
R4476:Cntn6 UTSW 6 104772561 missense probably damaging 1.00
R4664:Cntn6 UTSW 6 104728284 missense probably benign 0.20
R4666:Cntn6 UTSW 6 104728284 missense probably benign 0.20
R4701:Cntn6 UTSW 6 104804360 missense probably benign 0.01
R4780:Cntn6 UTSW 6 104845784 missense probably damaging 1.00
R4854:Cntn6 UTSW 6 104859475 missense possibly damaging 0.95
R4965:Cntn6 UTSW 6 104774474 missense probably damaging 0.99
R5075:Cntn6 UTSW 6 104833030 missense probably damaging 1.00
R5152:Cntn6 UTSW 6 104569113 intron probably benign
R5291:Cntn6 UTSW 6 104726135 missense probably damaging 1.00
R5388:Cntn6 UTSW 6 104832562 missense probably damaging 1.00
R5852:Cntn6 UTSW 6 104835745 missense probably damaging 0.97
R5937:Cntn6 UTSW 6 104833103 missense possibly damaging 0.68
R5980:Cntn6 UTSW 6 104848132 missense probably damaging 0.98
R6290:Cntn6 UTSW 6 104767890 missense probably damaging 1.00
R6338:Cntn6 UTSW 6 104726139 missense probably damaging 1.00
R6396:Cntn6 UTSW 6 104650500 missense probably damaging 1.00
R6447:Cntn6 UTSW 6 104859448 missense probably damaging 1.00
R6860:Cntn6 UTSW 6 104861946 missense possibly damaging 0.95
R6871:Cntn6 UTSW 6 104845758 frame shift probably null
R7012:Cntn6 UTSW 6 104726262 missense probably damaging 0.98
R7012:Cntn6 UTSW 6 104774480 missense probably benign 0.01
R7337:Cntn6 UTSW 6 104650530 missense probably damaging 0.99
R7658:Cntn6 UTSW 6 104650483 missense probably benign 0.29
R8133:Cntn6 UTSW 6 104728337 missense probably benign 0.19
R8463:Cntn6 UTSW 6 104772619 missense possibly damaging 0.64
R8909:Cntn6 UTSW 6 104848132 missense probably benign 0.05
R9232:Cntn6 UTSW 6 104838820 missense probably damaging 1.00
R9287:Cntn6 UTSW 6 104832510 missense possibly damaging 0.89
R9454:Cntn6 UTSW 6 104804347 missense possibly damaging 0.82
R9698:Cntn6 UTSW 6 104833083 nonsense probably null
X0020:Cntn6 UTSW 6 104767884 missense probably benign 0.00
Z1177:Cntn6 UTSW 6 104832584 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATAATTGTGATGGTTGCCCC -3'
(R):5'- GCACACTGAATGCTCCATAGAC -3'

Sequencing Primer
(F):5'- ATAATTGTGATGGTTGCCCCTACTAG -3'
(R):5'- TGAATGCTCCATAGACATGAGC -3'
Posted On 2016-06-15