Incidental Mutation 'R5051:Sympk'
ID394646
Institutional Source Beutler Lab
Gene Symbol Sympk
Ensembl Gene ENSMUSG00000023118
Gene Namesymplekin
Synonyms
MMRRC Submission 042641-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.970) question?
Stock #R5051 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location19024377-19054618 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 19036042 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 215 (R215C)
Ref Sequence ENSEMBL: ENSMUSP00000023882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023882] [ENSMUST00000146903] [ENSMUST00000153976]
Predicted Effect probably benign
Transcript: ENSMUST00000023882
AA Change: R215C

PolyPhen 2 Score 0.192 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000023882
Gene: ENSMUSG00000023118
AA Change: R215C

DomainStartEndE-ValueType
low complexity region 106 118 N/A INTRINSIC
Pfam:DUF3453 119 352 1.1e-63 PFAM
low complexity region 473 485 N/A INTRINSIC
Pfam:Symplekin_C 887 1068 4.3e-78 PFAM
low complexity region 1123 1149 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137287
Predicted Effect probably benign
Transcript: ENSMUST00000146903
AA Change: R215C

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000138740
Gene: ENSMUSG00000023118
AA Change: R215C

DomainStartEndE-ValueType
Pfam:DUF3453 117 230 1.1e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153976
SMART Domains Protein: ENSMUSP00000121540
Gene: ENSMUSG00000023118

DomainStartEndE-ValueType
Pfam:Cohesin_HEAT 48 96 9e-7 PFAM
Pfam:DUF3453 117 198 2.2e-24 PFAM
Meta Mutation Damage Score 0.1910 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.3%
  • 10x: 95.9%
  • 20x: 90.6%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein that functions in the regulation of polyadenylation and promotes gene expression. The protein forms a high-molecular weight complex with components of the polyadenylation machinery. It is thought to serve as a scaffold for recruiting regulatory factors to the polyadenylation complex. It also participates in 3'-end maturation of histone mRNAs, which do not undergo polyadenylation. The protein also localizes to the cytoplasmic plaques of tight junctions in some cell types. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous ofr a transgenic gene disruption exhibit anemia at E15 and hydrops fetalis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T A 1: 105,691,986 N313K possibly damaging Het
5730522E02Rik G A 11: 25,768,990 T51I unknown Het
Alms1 C T 6: 85,627,934 Q2189* probably null Het
Ank1 A T 8: 23,119,381 D1363V probably damaging Het
Ap3d1 T G 10: 80,719,199 T431P probably damaging Het
Arnt A G 3: 95,470,337 T125A probably benign Het
Atp10a TGTCCGTC TGTC 7: 58,740,246 probably null Het
Bscl2 A T 19: 8,845,279 R195* probably null Het
Ccdc146 C T 5: 21,303,083 V656I possibly damaging Het
Ccr4 T C 9: 114,492,646 Y117C probably damaging Het
Cd55 T A 1: 130,448,348 D355V probably damaging Het
Cntn6 T A 6: 104,772,597 I259N probably damaging Het
Cspg4 A G 9: 56,885,736 I252V possibly damaging Het
Dmbt1 T C 7: 131,094,742 V895A probably benign Het
Ect2 A G 3: 27,102,486 V775A probably benign Het
Gm14486 T C 2: 30,658,877 noncoding transcript Het
Grin2b T C 6: 135,779,395 N444S possibly damaging Het
Heatr5b T C 17: 78,795,274 D1225G probably damaging Het
Il1rl2 G A 1: 40,343,094 V189I probably benign Het
Kif1a G A 1: 93,076,154 probably null Het
Ltbr T A 6: 125,312,770 T154S probably damaging Het
Mrgpra6 C T 7: 47,185,942 V244I probably benign Het
Myo15 G A 11: 60,487,425 probably null Het
Ndufs1 A G 1: 63,164,947 probably null Het
Nectin3 A T 16: 46,448,550 N496K possibly damaging Het
Nkd2 A G 13: 73,825,076 V147A probably benign Het
Nlrp3 G C 11: 59,566,199 R1013P probably benign Het
Olfr1280 T A 2: 111,316,254 Y258* probably null Het
Olfr1423 C A 19: 12,035,924 V273F possibly damaging Het
Pdk2 T C 11: 95,028,772 S263G probably benign Het
Pla2g4e T A 2: 120,174,304 I520F probably damaging Het
Plat A G 8: 22,773,672 T196A probably benign Het
Podn T A 4: 108,014,846 D400V probably benign Het
Poteg T C 8: 27,453,329 V147A possibly damaging Het
Prkar2a A G 9: 108,745,491 N315D probably benign Het
Rac2 A G 15: 78,564,934 I13T possibly damaging Het
Rangap1 A C 15: 81,710,463 D388E probably benign Het
Sp140 T A 1: 85,610,828 D95E possibly damaging Het
Supv3l1 A C 10: 62,443,417 I240S probably damaging Het
Tead4 A C 6: 128,294,299 probably benign Het
Tex10 G A 4: 48,460,019 A444V possibly damaging Het
Tgds A T 14: 118,128,227 I73K probably damaging Het
Tmem117 C A 15: 94,714,913 T110K probably damaging Het
Trim30a T A 7: 104,411,706 probably benign Het
Unc80 C T 1: 66,509,477 T636I probably damaging Het
Wisp3 A G 10: 39,155,156 F124L probably benign Het
Ybey G A 10: 76,468,339 R10W probably damaging Het
Zap70 A G 1: 36,781,451 I576V probably benign Het
Zfp64 T C 2: 168,926,384 D436G probably damaging Het
Other mutations in Sympk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01114:Sympk APN 7 19047573 missense probably benign 0.14
IGL01834:Sympk APN 7 19043435 missense probably benign 0.02
IGL02588:Sympk APN 7 19042625 missense probably benign
IGL02601:Sympk APN 7 19048869 missense probably benign 0.31
IGL02645:Sympk APN 7 19052424 missense probably damaging 0.99
IGL02698:Sympk APN 7 19045634 missense probably benign 0.35
IGL02709:Sympk APN 7 19047538 missense probably benign 0.26
IGL02814:Sympk APN 7 19053273 missense probably damaging 1.00
IGL03198:Sympk APN 7 19044996 missense possibly damaging 0.92
butterfinger UTSW 7 19048453 missense probably damaging 0.98
fifth_avenue UTSW 7 19043460 missense possibly damaging 0.83
IGL02991:Sympk UTSW 7 19030577 missense probably damaging 1.00
R0391:Sympk UTSW 7 19046849 missense probably benign 0.06
R1036:Sympk UTSW 7 19048453 missense probably damaging 0.98
R1872:Sympk UTSW 7 19029145 missense probably benign
R2058:Sympk UTSW 7 19043529 missense probably damaging 1.00
R2103:Sympk UTSW 7 19054116 missense probably benign
R2966:Sympk UTSW 7 19030544 missense probably damaging 1.00
R3110:Sympk UTSW 7 19034484 missense possibly damaging 0.69
R3112:Sympk UTSW 7 19034484 missense possibly damaging 0.69
R3703:Sympk UTSW 7 19040561 missense probably damaging 0.99
R3775:Sympk UTSW 7 19035955 missense probably damaging 1.00
R3930:Sympk UTSW 7 19047522 missense possibly damaging 0.90
R4638:Sympk UTSW 7 19043460 missense possibly damaging 0.83
R4639:Sympk UTSW 7 19043460 missense possibly damaging 0.83
R4645:Sympk UTSW 7 19043460 missense possibly damaging 0.83
R4688:Sympk UTSW 7 19054410 missense probably benign
R5050:Sympk UTSW 7 19036042 missense probably benign 0.19
R5052:Sympk UTSW 7 19036042 missense probably benign 0.19
R5092:Sympk UTSW 7 19042659 missense probably benign 0.17
R5211:Sympk UTSW 7 19035889 missense probably benign 0.22
R5591:Sympk UTSW 7 19054039 missense probably damaging 1.00
R5678:Sympk UTSW 7 19049472 critical splice donor site probably null
R5972:Sympk UTSW 7 19046824 missense probably benign
R6387:Sympk UTSW 7 19052498 missense possibly damaging 0.94
R6543:Sympk UTSW 7 19036830 missense probably damaging 1.00
R6984:Sympk UTSW 7 19038043 missense probably benign 0.00
R7141:Sympk UTSW 7 19054092 missense probably benign
R7292:Sympk UTSW 7 19036030 missense probably benign 0.01
R7319:Sympk UTSW 7 19035845 missense probably benign
R7887:Sympk UTSW 7 19034439 missense possibly damaging 0.69
R8094:Sympk UTSW 7 19053448 critical splice donor site probably null
R8147:Sympk UTSW 7 19036793 missense probably damaging 0.98
RF064:Sympk UTSW 7 19034395 frame shift probably null
X0017:Sympk UTSW 7 19040663 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- CATGGTGTCCTCTATGGCTG -3'
(R):5'- GGCAACAGCATTGTGGGATG -3'

Sequencing Primer
(F):5'- CCTCTATGGCTGGGGAAATCATC -3'
(R):5'- TTTACGGCAGGCAAGCACTTTAC -3'
Posted On2016-06-15