Incidental Mutation 'R0448:Nup153'
Institutional Source Beutler Lab
Gene Symbol Nup153
Ensembl Gene ENSMUSG00000021374
Gene Namenucleoporin 153
MMRRC Submission 038648-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.948) question?
Stock #R0448 (G1)
Quality Score225
Status Validated
Chromosomal Location46679905-46727940 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46717181 bp
Amino Acid Change Glutamic Acid to Glycine at position 86 (E86G)
Ref Sequence ENSEMBL: ENSMUSP00000021803 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021803]
Predicted Effect probably benign
Transcript: ENSMUST00000021803
AA Change: E86G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000021803
Gene: ENSMUSG00000021374
AA Change: E86G

low complexity region 6 15 N/A INTRINSIC
Pfam:Nup153 114 627 6e-236 PFAM
ZnF_RBZ 656 680 6.56e-6 SMART
ZnF_RBZ 719 743 5.89e-8 SMART
low complexity region 756 775 N/A INTRINSIC
ZnF_RBZ 787 811 7.2e-3 SMART
low complexity region 815 830 N/A INTRINSIC
ZnF_RBZ 844 868 1.64e-6 SMART
low complexity region 898 911 N/A INTRINSIC
low complexity region 1078 1085 N/A INTRINSIC
low complexity region 1183 1207 N/A INTRINSIC
low complexity region 1248 1260 N/A INTRINSIC
low complexity region 1271 1296 N/A INTRINSIC
Pfam:Nup_retrotrp_bd 1372 1462 4.4e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183299
Predicted Effect unknown
Transcript: ENSMUST00000224062
AA Change: E29G
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 93.1%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nuclear pore complexes regulate the transport of macromolecules between the nucleus and cytoplasm. They are composed of at least 100 different polypeptide subunits, many of which belong to the nucleoporin family. Nucleoporins are glycoproteins found in nuclear pores and contain characteristic pentapeptide XFXFG repeats as well as O-linked N-acetylglucosamine residues oriented towards the cytoplasm. The protein encoded by this gene has three distinct domains: a N-terminal region containing a pore targeting and an RNA-binding domain domain, a central region containing multiple zinc finger motifs, and a C-terminal region containing multiple XFXFG repeats. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, May 2013]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A T 6: 48,933,057 S643C probably damaging Het
9530053A07Rik T C 7: 28,140,235 I491T probably benign Het
Abcc5 G A 16: 20,399,937 R232C probably damaging Het
Adam9 A G 8: 24,964,910 S732P probably damaging Het
Add2 G A 6: 86,092,919 V140I probably benign Het
Ahi1 G A 10: 20,972,075 G461S probably damaging Het
Arhgef7 A G 8: 11,819,659 T432A possibly damaging Het
Arsi T C 18: 60,917,302 I419T probably damaging Het
Brca1 G A 11: 101,508,221 P1515L possibly damaging Het
Brcc3 T A X: 75,450,041 L222* probably null Het
Brpf3 A T 17: 28,806,036 T28S probably benign Het
Cdc20b T A 13: 113,078,657 V253E probably damaging Het
Cnot6l T A 5: 96,080,046 S443C probably benign Het
Copg1 G A 6: 87,904,926 A587T probably benign Het
Crebrf A G 17: 26,743,102 D391G probably benign Het
Crocc A T 4: 141,042,191 D283E probably damaging Het
Cryga T C 1: 65,103,159 N25S probably benign Het
Csnk1g1 T C 9: 65,980,948 F90L possibly damaging Het
Cyp2j6 A G 4: 96,545,728 V115A probably benign Het
Cyp3a11 T C 5: 145,862,394 I328V probably benign Het
Dchs1 C A 7: 105,765,927 E683D probably benign Het
Dnah9 T C 11: 65,918,713 probably benign Het
Dqx1 T C 6: 83,060,345 S330P probably damaging Het
Epg5 A G 18: 78,023,365 Y2160C probably damaging Het
Ercc5 T C 1: 44,173,940 L742P probably damaging Het
Flt1 C T 5: 147,566,394 probably benign Het
Gm9513 T A 9: 36,477,116 M79K probably benign Het
Grip2 A G 6: 91,779,213 S498P probably damaging Het
H2-T22 A G 17: 36,042,386 L14P possibly damaging Het
Hephl1 C T 9: 15,076,926 G629S probably damaging Het
Hsdl2 T A 4: 59,606,523 M162K unknown Het
Kcnh8 C A 17: 52,977,620 probably null Het
Krt76 T C 15: 101,890,647 Q201R probably damaging Het
Lrpprc A T 17: 84,770,894 Y319N probably benign Het
Lrrk2 T G 15: 91,709,305 I489R probably damaging Het
Mboat1 G T 13: 30,202,410 D136Y probably damaging Het
Mcmdc2 T C 1: 9,940,542 *682Q probably null Het
Msx2 C A 13: 53,468,395 R193L probably damaging Het
Nfatc4 T G 14: 55,831,654 D625E possibly damaging Het
Olfr1295 T A 2: 111,565,214 I77F probably benign Het
Olfr130 G T 17: 38,067,672 R167L probably benign Het
Pard3b T C 1: 62,166,469 L474P probably damaging Het
Pggt1b A T 18: 46,262,972 probably benign Het
Pik3r2 A G 8: 70,772,044 probably benign Het
Prr14 A G 7: 127,474,726 probably benign Het
Rcbtb2 T C 14: 73,178,429 probably benign Het
Rufy2 G A 10: 63,004,736 D429N probably benign Het
S1pr5 T A 9: 21,244,207 T308S probably damaging Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Serpina12 A G 12: 104,038,095 S93P probably benign Het
Serpinb1b T G 13: 33,089,692 H123Q probably benign Het
Sftpc C T 14: 70,522,680 V46I probably benign Het
Skint8 T A 4: 111,936,890 V159D probably damaging Het
Slc25a11 T C 11: 70,645,579 N134S probably benign Het
Slc25a24 T C 3: 109,157,016 probably benign Het
Sorl1 C G 9: 42,004,088 V1282L probably damaging Het
Sptan1 T A 2: 30,026,810 I2170N probably damaging Het
Syne4 A G 7: 30,314,920 probably benign Het
Tcam1 G A 11: 106,284,078 E120K probably benign Het
Tg C A 15: 66,764,442 P626Q probably damaging Het
Thoc6 T A 17: 23,669,576 D196V probably damaging Het
Tpi1 A G 6: 124,814,103 F57S probably damaging Het
Tril A G 6: 53,817,808 *810Q probably null Het
Trrap T A 5: 144,839,567 V2972D possibly damaging Het
Ttn T C 2: 76,720,939 M31370V probably damaging Het
Ttn A T 2: 76,761,280 V12688E probably damaging Het
Txndc11 A G 16: 11,091,761 F307S probably damaging Het
Vmn1r40 C T 6: 89,714,660 S153L probably benign Het
Vmn2r95 A G 17: 18,451,743 T581A possibly damaging Het
Wdtc1 A G 4: 133,297,500 F462S probably damaging Het
Zfp101 A G 17: 33,382,321 S154P possibly damaging Het
Zmym6 A G 4: 127,108,694 N481D probably benign Het
Other mutations in Nup153
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00657:Nup153 APN 13 46681150 unclassified probably benign
IGL01312:Nup153 APN 13 46686824 missense probably benign 0.03
IGL01459:Nup153 APN 13 46712926 missense possibly damaging 0.84
IGL01646:Nup153 APN 13 46684107 missense possibly damaging 0.80
IGL03064:Nup153 APN 13 46693839 missense probably benign
IGL03288:Nup153 APN 13 46705205 missense possibly damaging 0.71
IGL03369:Nup153 APN 13 46700983 splice site probably null
IGL03371:Nup153 APN 13 46683152 missense probably benign 0.34
R0193:Nup153 UTSW 13 46709654 missense probably benign 0.01
R0244:Nup153 UTSW 13 46693936 missense probably benign 0.03
R0943:Nup153 UTSW 13 46696772 splice site probably benign
R1219:Nup153 UTSW 13 46687219 missense probably benign 0.01
R1381:Nup153 UTSW 13 46689181 missense probably damaging 1.00
R1709:Nup153 UTSW 13 46693974 missense probably damaging 1.00
R1727:Nup153 UTSW 13 46693785 missense probably damaging 1.00
R1818:Nup153 UTSW 13 46681637 missense possibly damaging 0.94
R1824:Nup153 UTSW 13 46713747 missense probably damaging 1.00
R1928:Nup153 UTSW 13 46701026 missense probably damaging 0.98
R2108:Nup153 UTSW 13 46693510 critical splice donor site probably null
R2110:Nup153 UTSW 13 46683928 missense probably benign 0.00
R2111:Nup153 UTSW 13 46683928 missense probably benign 0.00
R2173:Nup153 UTSW 13 46701600 splice site probably benign
R2231:Nup153 UTSW 13 46709627 critical splice donor site probably null
R3879:Nup153 UTSW 13 46683960 missense probably damaging 1.00
R4634:Nup153 UTSW 13 46687230 missense possibly damaging 0.49
R4662:Nup153 UTSW 13 46687274 missense possibly damaging 0.68
R4932:Nup153 UTSW 13 46712737 nonsense probably null
R5011:Nup153 UTSW 13 46687403 missense possibly damaging 0.62
R5023:Nup153 UTSW 13 46681109 unclassified probably benign
R5069:Nup153 UTSW 13 46709792 missense probably benign 0.05
R5137:Nup153 UTSW 13 46684153 missense probably damaging 0.99
R5323:Nup153 UTSW 13 46717206 missense probably benign 0.19
R5345:Nup153 UTSW 13 46686865 nonsense probably null
R5536:Nup153 UTSW 13 46683009 missense probably benign 0.01
R5613:Nup153 UTSW 13 46687271 missense possibly damaging 0.64
R5620:Nup153 UTSW 13 46684006 nonsense probably null
R5764:Nup153 UTSW 13 46687327 missense probably damaging 0.97
R5849:Nup153 UTSW 13 46686976 missense probably damaging 0.99
R6454:Nup153 UTSW 13 46709660 unclassified probably null
R6701:Nup153 UTSW 13 46687065 missense probably benign 0.00
R6721:Nup153 UTSW 13 46701026 missense probably damaging 0.98
R6737:Nup153 UTSW 13 46689206 missense probably benign 0.08
R6789:Nup153 UTSW 13 46717316 missense probably damaging 1.00
R6820:Nup153 UTSW 13 46709983 missense probably benign 0.09
R6837:Nup153 UTSW 13 46694051 missense probably damaging 1.00
R6913:Nup153 UTSW 13 46699716 missense probably damaging 1.00
R7052:Nup153 UTSW 13 46687473 missense probably benign 0.09
R7091:Nup153 UTSW 13 46683928 missense probably benign
R7357:Nup153 UTSW 13 46717166 missense probably benign 0.32
R7389:Nup153 UTSW 13 46700987 critical splice donor site probably null
R7423:Nup153 UTSW 13 46696644 critical splice donor site probably null
R7453:Nup153 UTSW 13 46681181 missense probably damaging 1.00
R7611:Nup153 UTSW 13 46687322 missense probably benign 0.01
R7876:Nup153 UTSW 13 46681608 missense probably benign
R7909:Nup153 UTSW 13 46693580 missense probably damaging 1.00
R7959:Nup153 UTSW 13 46681608 missense probably benign
R7990:Nup153 UTSW 13 46693580 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- aagaaagagaggactccatcac -3'
Posted On2013-05-23