Incidental Mutation 'R5051:Rac2'
ID394668
Institutional Source Beutler Lab
Gene Symbol Rac2
Ensembl Gene ENSMUSG00000033220
Gene NameRac family small GTPase 2
Synonyms
MMRRC Submission 042641-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5051 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location78559167-78572783 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78564934 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 13 (I13T)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043214] [ENSMUST00000229394]
Predicted Effect probably benign
Transcript: ENSMUST00000043214
AA Change: I126T

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000036384
Gene: ENSMUSG00000033220
AA Change: I126T

DomainStartEndE-ValueType
RHO 6 179 3.36e-135 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000229394
Predicted Effect possibly damaging
Transcript: ENSMUST00000230952
AA Change: I13T

PolyPhen 2 Score 0.682 (Sensitivity: 0.86; Specificity: 0.92)
Meta Mutation Damage Score 0.1368 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.3%
  • 10x: 95.9%
  • 20x: 90.6%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ras superfamily of small guanosine triphosphate (GTP)-metabolizing proteins. The encoded protein localizes to the plasma membrane, where it regulates diverse processes, such as secretion, phagocytosis, and cell polarization. Activity of this protein is also involved in the generation of reactive oxygen species. Mutations in this gene are associated with neutrophil immunodeficiency syndrome. There is a pseudogene for this gene on chromosome 6. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit peripheral blood lymphocytosis, reductions in peritoneal B-1a lymphocytes, marginal zone lymphocytes, and IgM-secreting plasma cells, decreased levels of serum IgM and IgA, and abnormal T cell migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T A 1: 105,691,986 N313K possibly damaging Het
5730522E02Rik G A 11: 25,768,990 T51I unknown Het
Alms1 C T 6: 85,627,934 Q2189* probably null Het
Ank1 A T 8: 23,119,381 D1363V probably damaging Het
Ap3d1 T G 10: 80,719,199 T431P probably damaging Het
Arnt A G 3: 95,470,337 T125A probably benign Het
Atp10a TGTCCGTC TGTC 7: 58,740,246 probably null Het
Bscl2 A T 19: 8,845,279 R195* probably null Het
Ccdc146 C T 5: 21,303,083 V656I possibly damaging Het
Ccr4 T C 9: 114,492,646 Y117C probably damaging Het
Cd55 T A 1: 130,448,348 D355V probably damaging Het
Cntn6 T A 6: 104,772,597 I259N probably damaging Het
Cspg4 A G 9: 56,885,736 I252V possibly damaging Het
Dmbt1 T C 7: 131,094,742 V895A probably benign Het
Ect2 A G 3: 27,102,486 V775A probably benign Het
Gm14486 T C 2: 30,658,877 noncoding transcript Het
Grin2b T C 6: 135,779,395 N444S possibly damaging Het
Heatr5b T C 17: 78,795,274 D1225G probably damaging Het
Il1rl2 G A 1: 40,343,094 V189I probably benign Het
Kif1a G A 1: 93,076,154 probably null Het
Ltbr T A 6: 125,312,770 T154S probably damaging Het
Mrgpra6 C T 7: 47,185,942 V244I probably benign Het
Myo15 G A 11: 60,487,425 probably null Het
Ndufs1 A G 1: 63,164,947 probably null Het
Nectin3 A T 16: 46,448,550 N496K possibly damaging Het
Nkd2 A G 13: 73,825,076 V147A probably benign Het
Nlrp3 G C 11: 59,566,199 R1013P probably benign Het
Olfr1280 T A 2: 111,316,254 Y258* probably null Het
Olfr1423 C A 19: 12,035,924 V273F possibly damaging Het
Pdk2 T C 11: 95,028,772 S263G probably benign Het
Pla2g4e T A 2: 120,174,304 I520F probably damaging Het
Plat A G 8: 22,773,672 T196A probably benign Het
Podn T A 4: 108,014,846 D400V probably benign Het
Poteg T C 8: 27,453,329 V147A possibly damaging Het
Prkar2a A G 9: 108,745,491 N315D probably benign Het
Rangap1 A C 15: 81,710,463 D388E probably benign Het
Sp140 T A 1: 85,610,828 D95E possibly damaging Het
Supv3l1 A C 10: 62,443,417 I240S probably damaging Het
Sympk C T 7: 19,036,042 R215C probably benign Het
Tead4 A C 6: 128,294,299 probably benign Het
Tex10 G A 4: 48,460,019 A444V possibly damaging Het
Tgds A T 14: 118,128,227 I73K probably damaging Het
Tmem117 C A 15: 94,714,913 T110K probably damaging Het
Trim30a T A 7: 104,411,706 probably benign Het
Unc80 C T 1: 66,509,477 T636I probably damaging Het
Wisp3 A G 10: 39,155,156 F124L probably benign Het
Ybey G A 10: 76,468,339 R10W probably damaging Het
Zap70 A G 1: 36,781,451 I576V probably benign Het
Zfp64 T C 2: 168,926,384 D436G probably damaging Het
Other mutations in Rac2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02931:Rac2 APN 15 78570747 missense possibly damaging 0.79
Big_bend UTSW 15 78565945 missense possibly damaging 0.95
bingo UTSW 15 78564968 missense probably damaging 1.00
Lamb UTSW 15 78564934 missense possibly damaging 0.68
Potter UTSW 15 78570743 nonsense probably null
Potter2 UTSW 15 78565454 missense probably damaging 0.97
wheel UTSW 15 78566006 missense probably benign 0.29
R0557:Rac2 UTSW 15 78564974 missense probably damaging 1.00
R0627:Rac2 UTSW 15 78564968 missense probably damaging 1.00
R0751:Rac2 UTSW 15 78565945 missense possibly damaging 0.95
R1184:Rac2 UTSW 15 78565945 missense possibly damaging 0.95
R2349:Rac2 UTSW 15 78565475 missense possibly damaging 0.51
R3816:Rac2 UTSW 15 78565999 missense possibly damaging 0.75
R4436:Rac2 UTSW 15 78570743 nonsense probably null
R5207:Rac2 UTSW 15 78565454 missense probably damaging 0.97
R7384:Rac2 UTSW 15 78561931 nonsense probably null
R8482:Rac2 UTSW 15 78566006 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- CCAAGTCATTTTACCCAGGCAC -3'
(R):5'- AGATCCTGCTCTGCCTTGTG -3'

Sequencing Primer
(F):5'- TCACACAGCTGGTACAATGGTTG -3'
(R):5'- TTGTGACCCTCCCGCTAGG -3'
Posted On2016-06-15