Incidental Mutation 'R5052:Ipo9'
ID394677
Institutional Source Beutler Lab
Gene Symbol Ipo9
Ensembl Gene ENSMUSG00000041879
Gene Nameimportin 9
Synonyms
MMRRC Submission 042642-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5052 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location135382312-135430499 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 135388611 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000041023] [ENSMUST00000161032] [ENSMUST00000161189]
Predicted Effect probably benign
Transcript: ENSMUST00000041023
AA Change: S826G

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000036093
Gene: ENSMUSG00000041879
AA Change: S826G

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
IBN_N 43 119 3.83e-7 SMART
low complexity region 911 922 N/A INTRINSIC
low complexity region 978 990 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159089
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159487
Predicted Effect probably benign
Transcript: ENSMUST00000161032
SMART Domains Protein: ENSMUSP00000124779
Gene: ENSMUSG00000041879

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
IBN_N 43 119 3.83e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161189
SMART Domains Protein: ENSMUSP00000124492
Gene: ENSMUSG00000041879

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
SCOP:d1i6la_ 21 52 4e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161258
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161750
Predicted Effect probably null
Transcript: ENSMUST00000161934
SMART Domains Protein: ENSMUSP00000124210
Gene: ENSMUSG00000041879

DomainStartEndE-ValueType
low complexity region 81 92 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162858
Meta Mutation Damage Score 0.0795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.0%
  • 10x: 94.8%
  • 20x: 86.2%
Validation Efficiency 100% (58/58)
MGI Phenotype PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E7. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd3 A T 3: 121,769,513 probably null Het
Adgrv1 T C 13: 81,528,821 T1964A probably damaging Het
Agbl5 C T 5: 30,891,214 T210I possibly damaging Het
Ak5 T C 3: 152,660,567 T66A probably benign Het
Aktip G A 8: 91,129,651 T66I possibly damaging Het
Aldh1l2 T C 10: 83,508,692 Y330C possibly damaging Het
Btbd19 T G 4: 117,122,257 K122Q possibly damaging Het
Cd180 A G 13: 102,704,895 T150A probably benign Het
Celsr2 A G 3: 108,412,358 I1046T probably damaging Het
Cep170 C T 1: 176,793,551 R20Q probably damaging Het
Cercam T A 2: 29,875,627 N260K probably damaging Het
Cfh T A 1: 140,144,044 H284L probably damaging Het
Chmp5 A G 4: 40,948,608 M1V probably null Het
Elp3 A T 14: 65,577,940 I220N probably damaging Het
Esyt2 A G 12: 116,367,796 T765A probably damaging Het
Evi5l T C 8: 4,206,019 probably benign Het
Gm5866 T G 5: 52,582,892 noncoding transcript Het
Grik1 C A 16: 87,950,098 G417V probably benign Het
Gtpbp1 T G 15: 79,715,969 I399R probably damaging Het
Il17rc T C 6: 113,472,323 C14R probably damaging Het
Kazn G A 4: 142,118,203 probably benign Het
Map3k15 T C X: 159,988,746 V105A possibly damaging Het
Mitf A G 6: 98,010,445 T320A possibly damaging Het
Ncapd3 T G 9: 27,051,719 L440R probably damaging Het
Nrxn2 C G 19: 6,455,204 A359G probably damaging Het
P2rx3 T G 2: 84,999,024 I371L probably benign Het
Pde1b C A 15: 103,527,648 Q493K possibly damaging Het
Ptpn13 T C 5: 103,561,980 F1503S probably damaging Het
Ptprz1 T G 6: 23,045,626 W1283G probably damaging Het
Rasd2 T A 8: 75,221,936 D163E possibly damaging Het
Rgs11 A G 17: 26,207,973 probably benign Het
Scap T C 9: 110,353,152 I37T possibly damaging Het
Sgms2 C T 3: 131,330,356 V232M probably benign Het
Slc25a54 A G 3: 109,102,700 I172V probably benign Het
Sympk C T 7: 19,036,042 R215C probably benign Het
Tacc2 T A 7: 130,735,014 D171E probably damaging Het
Tmco4 A G 4: 139,058,506 E629G probably benign Het
Trav7-1 T G 14: 52,655,308 L106R possibly damaging Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Utf1 T C 7: 139,944,901 probably benign Het
Zdhhc13 A G 7: 48,824,731 N577S possibly damaging Het
Zmym6 A G 4: 127,123,974 N1183D possibly damaging Het
Other mutations in Ipo9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00896:Ipo9 APN 1 135400059 missense probably damaging 1.00
IGL01611:Ipo9 APN 1 135386693 missense possibly damaging 0.76
IGL01941:Ipo9 APN 1 135408073 missense possibly damaging 0.95
IGL01944:Ipo9 APN 1 135405886 missense probably damaging 0.98
IGL01959:Ipo9 APN 1 135420355 critical splice acceptor site probably null
IGL02649:Ipo9 APN 1 135385934 missense possibly damaging 0.92
IGL02697:Ipo9 APN 1 135390576 missense probably benign 0.00
IGL03286:Ipo9 APN 1 135407078 intron probably benign
FR4304:Ipo9 UTSW 1 135386275 small insertion probably benign
FR4304:Ipo9 UTSW 1 135386279 nonsense probably null
FR4340:Ipo9 UTSW 1 135386269 small insertion probably benign
FR4340:Ipo9 UTSW 1 135386271 small insertion probably benign
FR4548:Ipo9 UTSW 1 135386275 small insertion probably benign
FR4589:Ipo9 UTSW 1 135386266 small insertion probably benign
FR4589:Ipo9 UTSW 1 135386281 small insertion probably benign
FR4976:Ipo9 UTSW 1 135386281 small insertion probably benign
R0111:Ipo9 UTSW 1 135405924 missense probably damaging 0.97
R0238:Ipo9 UTSW 1 135404336 splice site probably benign
R0239:Ipo9 UTSW 1 135404336 splice site probably benign
R0279:Ipo9 UTSW 1 135420363 intron probably benign
R0704:Ipo9 UTSW 1 135386268 small deletion probably benign
R1070:Ipo9 UTSW 1 135406543 missense possibly damaging 0.89
R1282:Ipo9 UTSW 1 135402292 missense possibly damaging 0.48
R1467:Ipo9 UTSW 1 135406543 missense possibly damaging 0.89
R1467:Ipo9 UTSW 1 135406543 missense possibly damaging 0.89
R1728:Ipo9 UTSW 1 135386268 small insertion probably benign
R1728:Ipo9 UTSW 1 135386271 small insertion probably benign
R1728:Ipo9 UTSW 1 135402250 missense probably benign
R1729:Ipo9 UTSW 1 135386268 small insertion probably benign
R1729:Ipo9 UTSW 1 135402250 missense probably benign
R1730:Ipo9 UTSW 1 135386268 small insertion probably benign
R1730:Ipo9 UTSW 1 135402250 missense probably benign
R1739:Ipo9 UTSW 1 135386268 small insertion probably benign
R1739:Ipo9 UTSW 1 135402250 missense probably benign
R1762:Ipo9 UTSW 1 135386268 small insertion probably benign
R1762:Ipo9 UTSW 1 135402250 missense probably benign
R1783:Ipo9 UTSW 1 135386268 small insertion probably benign
R1783:Ipo9 UTSW 1 135402250 missense probably benign
R1784:Ipo9 UTSW 1 135386268 small insertion probably benign
R1784:Ipo9 UTSW 1 135402250 missense probably benign
R1785:Ipo9 UTSW 1 135386268 small insertion probably benign
R1785:Ipo9 UTSW 1 135386281 small insertion probably benign
R1785:Ipo9 UTSW 1 135402250 missense probably benign
R1899:Ipo9 UTSW 1 135400146 missense probably damaging 0.99
R2049:Ipo9 UTSW 1 135386268 small insertion probably benign
R2049:Ipo9 UTSW 1 135402250 missense probably benign
R2130:Ipo9 UTSW 1 135386268 small insertion probably benign
R2130:Ipo9 UTSW 1 135402250 missense probably benign
R2131:Ipo9 UTSW 1 135386268 small insertion probably benign
R2131:Ipo9 UTSW 1 135402250 missense probably benign
R2133:Ipo9 UTSW 1 135386268 small insertion probably benign
R2133:Ipo9 UTSW 1 135386275 small insertion probably benign
R2133:Ipo9 UTSW 1 135402250 missense probably benign
R2136:Ipo9 UTSW 1 135394285 missense probably damaging 0.98
R2141:Ipo9 UTSW 1 135386268 small insertion probably benign
R2141:Ipo9 UTSW 1 135402250 missense probably benign
R2142:Ipo9 UTSW 1 135386268 small insertion probably benign
R2142:Ipo9 UTSW 1 135386275 small insertion probably benign
R2142:Ipo9 UTSW 1 135386282 small insertion probably benign
R2142:Ipo9 UTSW 1 135402250 missense probably benign
R2356:Ipo9 UTSW 1 135406817 missense probably benign 0.00
R2923:Ipo9 UTSW 1 135400129 missense probably benign 0.25
R3161:Ipo9 UTSW 1 135409476 missense probably benign 0.43
R3162:Ipo9 UTSW 1 135409476 missense probably benign 0.43
R3162:Ipo9 UTSW 1 135409476 missense probably benign 0.43
R4086:Ipo9 UTSW 1 135388690 unclassified probably benign
R4679:Ipo9 UTSW 1 135394169 missense probably benign
R4816:Ipo9 UTSW 1 135406550 missense probably benign 0.21
R4956:Ipo9 UTSW 1 135404222 critical splice donor site probably null
R5055:Ipo9 UTSW 1 135402359 nonsense probably null
R5230:Ipo9 UTSW 1 135420070 missense probably damaging 1.00
R5240:Ipo9 UTSW 1 135389606 unclassified probably benign
R5257:Ipo9 UTSW 1 135385435 missense probably damaging 1.00
R5340:Ipo9 UTSW 1 135385432 missense probably benign 0.00
R5560:Ipo9 UTSW 1 135402245 missense probably damaging 0.99
R5602:Ipo9 UTSW 1 135402245 missense probably damaging 0.99
R5604:Ipo9 UTSW 1 135402245 missense probably damaging 0.99
R5654:Ipo9 UTSW 1 135385472 nonsense probably null
R6018:Ipo9 UTSW 1 135390536 critical splice donor site probably null
R6128:Ipo9 UTSW 1 135390573 missense possibly damaging 0.90
R6841:Ipo9 UTSW 1 135386308 missense probably benign
R7230:Ipo9 UTSW 1 135406758 critical splice donor site probably benign
R7255:Ipo9 UTSW 1 135385988 missense probably benign 0.01
R7383:Ipo9 UTSW 1 135388673 missense probably damaging 1.00
Y5405:Ipo9 UTSW 1 135386269 small insertion probably benign
Y5405:Ipo9 UTSW 1 135386275 small insertion probably benign
Y5405:Ipo9 UTSW 1 135386284 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- TCAACGGTGTAAATCAGGGAC -3'
(R):5'- CCCATGTTCTGTCCTATGAGTGG -3'

Sequencing Primer
(F):5'- TCAGGGACGAAAGATTTAAATGTG -3'
(R):5'- GAGTCCAGTCTCTTGGAACTACAG -3'
Posted On2016-06-15