Incidental Mutation 'R5052:Cep170'
ID394679
Institutional Source Beutler Lab
Gene Symbol Cep170
Ensembl Gene ENSMUSG00000057335
Gene Namecentrosomal protein 170
Synonyms4933426L22Rik, A330004A13Rik
MMRRC Submission 042642-MU
Accession Numbers

Ncbi RefSeq: NM_001099637.2; MGI:1918348

Is this an essential gene? Possibly essential (E-score: 0.546) question?
Stock #R5052 (G1)
Quality Score203
Status Validated
Chromosome1
Chromosomal Location176733653-176814067 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 176793551 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 20 (R20Q)
Ref Sequence ENSEMBL: ENSMUSP00000141793 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057037] [ENSMUST00000192961] [ENSMUST00000194263] [ENSMUST00000194727] [ENSMUST00000195433] [ENSMUST00000195717]
Predicted Effect possibly damaging
Transcript: ENSMUST00000057037
AA Change: R20Q

PolyPhen 2 Score 0.830 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000059562
Gene: ENSMUSG00000057335
AA Change: R20Q

DomainStartEndE-ValueType
FHA 22 73 1.27e-7 SMART
low complexity region 118 133 N/A INTRINSIC
low complexity region 717 731 N/A INTRINSIC
low complexity region 738 750 N/A INTRINSIC
low complexity region 770 782 N/A INTRINSIC
Pfam:CEP170_C 801 1496 3.3e-264 PFAM
low complexity region 1533 1545 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122800
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192643
Predicted Effect probably damaging
Transcript: ENSMUST00000192961
AA Change: R20Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142271
Gene: ENSMUSG00000057335
AA Change: R20Q

DomainStartEndE-ValueType
FHA 22 73 1.27e-7 SMART
low complexity region 118 133 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194263
AA Change: R20Q

PolyPhen 2 Score 0.369 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000141720
Gene: ENSMUSG00000057335
AA Change: R20Q

DomainStartEndE-ValueType
FHA 22 73 6.1e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000194727
AA Change: R20Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141793
Gene: ENSMUSG00000057335
AA Change: R20Q

DomainStartEndE-ValueType
FHA 22 73 1.27e-7 SMART
low complexity region 118 133 N/A INTRINSIC
low complexity region 717 731 N/A INTRINSIC
low complexity region 738 750 N/A INTRINSIC
low complexity region 770 782 N/A INTRINSIC
Pfam:CEP170_C 795 1509 8e-260 PFAM
low complexity region 1543 1555 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000195433
AA Change: R20Q

PolyPhen 2 Score 0.532 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000142108
Gene: ENSMUSG00000057335
AA Change: R20Q

DomainStartEndE-ValueType
FHA 22 73 6.1e-10 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000195717
AA Change: R20Q

PolyPhen 2 Score 0.830 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000141769
Gene: ENSMUSG00000057335
AA Change: R20Q

DomainStartEndE-ValueType
FHA 22 73 1.27e-7 SMART
low complexity region 118 133 N/A INTRINSIC
low complexity region 717 731 N/A INTRINSIC
low complexity region 738 750 N/A INTRINSIC
low complexity region 770 782 N/A INTRINSIC
Pfam:CEP170_C 795 1499 1.8e-261 PFAM
low complexity region 1533 1545 N/A INTRINSIC
Meta Mutation Damage Score 0.3221 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.0%
  • 10x: 94.8%
  • 20x: 86.2%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a component of the centrosome, a non-membraneous organelle that functions as the major microtubule-organizing center in animal cells. During interphase, the encoded protein localizes to the sub-distal appendages of mature centrioles, which are microtubule-based structures thought to help organize centrosomes. During mitosis, the protein associates with spindle microtubules near the centrosomes. The protein interacts with and is phosphorylated by polo-like kinase 1, and functions in maintaining microtubule organization and cell morphology. The human genome contains a putative transcribed pseudogene. Several alternatively spliced transcript variants of this gene have been found, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(29) : Gene trapped(29)

Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd3 A T 3: 121,769,513 probably null Het
Adgrv1 T C 13: 81,528,821 T1964A probably damaging Het
Agbl5 C T 5: 30,891,214 T210I possibly damaging Het
Ak5 T C 3: 152,660,567 T66A probably benign Het
Aktip G A 8: 91,129,651 T66I possibly damaging Het
Aldh1l2 T C 10: 83,508,692 Y330C possibly damaging Het
Btbd19 T G 4: 117,122,257 K122Q possibly damaging Het
Cd180 A G 13: 102,704,895 T150A probably benign Het
Celsr2 A G 3: 108,412,358 I1046T probably damaging Het
Cercam T A 2: 29,875,627 N260K probably damaging Het
Cfh T A 1: 140,144,044 H284L probably damaging Het
Chmp5 A G 4: 40,948,608 M1V probably null Het
Elp3 A T 14: 65,577,940 I220N probably damaging Het
Esyt2 A G 12: 116,367,796 T765A probably damaging Het
Evi5l T C 8: 4,206,019 probably benign Het
Gm5866 T G 5: 52,582,892 noncoding transcript Het
Grik1 C A 16: 87,950,098 G417V probably benign Het
Gtpbp1 T G 15: 79,715,969 I399R probably damaging Het
Il17rc T C 6: 113,472,323 C14R probably damaging Het
Ipo9 T C 1: 135,388,611 probably null Het
Kazn G A 4: 142,118,203 probably benign Het
Map3k15 T C X: 159,988,746 V105A possibly damaging Het
Mitf A G 6: 98,010,445 T320A possibly damaging Het
Ncapd3 T G 9: 27,051,719 L440R probably damaging Het
Nrxn2 C G 19: 6,455,204 A359G probably damaging Het
P2rx3 T G 2: 84,999,024 I371L probably benign Het
Pde1b C A 15: 103,527,648 Q493K possibly damaging Het
Ptpn13 T C 5: 103,561,980 F1503S probably damaging Het
Ptprz1 T G 6: 23,045,626 W1283G probably damaging Het
Rasd2 T A 8: 75,221,936 D163E possibly damaging Het
Rgs11 A G 17: 26,207,973 probably benign Het
Scap T C 9: 110,353,152 I37T possibly damaging Het
Sgms2 C T 3: 131,330,356 V232M probably benign Het
Slc25a54 A G 3: 109,102,700 I172V probably benign Het
Sympk C T 7: 19,036,042 R215C probably benign Het
Tacc2 T A 7: 130,735,014 D171E probably damaging Het
Tmco4 A G 4: 139,058,506 E629G probably benign Het
Trav7-1 T G 14: 52,655,308 L106R possibly damaging Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Utf1 T C 7: 139,944,901 probably benign Het
Zdhhc13 A G 7: 48,824,731 N577S possibly damaging Het
Zmym6 A G 4: 127,123,974 N1183D possibly damaging Het
Other mutations in Cep170
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Cep170 APN 1 176755399 missense probably damaging 1.00
IGL00925:Cep170 APN 1 176793524 missense probably damaging 1.00
IGL00972:Cep170 APN 1 176735696 missense probably benign 0.00
IGL01488:Cep170 APN 1 176756375 missense probably benign 0.00
IGL01916:Cep170 APN 1 176739910 splice site probably benign
IGL02212:Cep170 APN 1 176735936 missense probably damaging 0.99
IGL02269:Cep170 APN 1 176769366 missense probably benign
IGL02732:Cep170 APN 1 176736874 missense probably damaging 1.00
IGL02740:Cep170 APN 1 176793600 missense probably damaging 1.00
IGL02812:Cep170 APN 1 176742514 missense probably damaging 1.00
IGL03036:Cep170 APN 1 176769337 missense possibly damaging 0.87
IGL03201:Cep170 APN 1 176736888 missense probably damaging 1.00
IGL03333:Cep170 APN 1 176769526 missense possibly damaging 0.64
PIT4520001:Cep170 UTSW 1 176780199 missense unknown
R0031:Cep170 UTSW 1 176756091 missense probably damaging 1.00
R0039:Cep170 UTSW 1 176782495 critical splice donor site probably null
R0053:Cep170 UTSW 1 176782380 missense possibly damaging 0.82
R0053:Cep170 UTSW 1 176782380 missense possibly damaging 0.82
R0113:Cep170 UTSW 1 176758455 missense probably damaging 0.97
R0144:Cep170 UTSW 1 176792595 missense probably benign 0.01
R0613:Cep170 UTSW 1 176774680 missense probably benign
R0755:Cep170 UTSW 1 176755753 missense probably damaging 1.00
R1132:Cep170 UTSW 1 176750037 missense probably damaging 1.00
R1367:Cep170 UTSW 1 176735724 missense probably damaging 0.99
R1399:Cep170 UTSW 1 176758403 missense probably damaging 0.98
R1462:Cep170 UTSW 1 176756645 missense possibly damaging 0.46
R1462:Cep170 UTSW 1 176756645 missense possibly damaging 0.46
R1481:Cep170 UTSW 1 176782385 missense possibly damaging 0.56
R1526:Cep170 UTSW 1 176788505 missense probably damaging 1.00
R1540:Cep170 UTSW 1 176739932 missense probably damaging 1.00
R1552:Cep170 UTSW 1 176782494 splice site probably benign
R1570:Cep170 UTSW 1 176755801 missense possibly damaging 0.64
R1846:Cep170 UTSW 1 176755769 missense probably damaging 1.00
R1884:Cep170 UTSW 1 176774679 missense probably benign 0.12
R1945:Cep170 UTSW 1 176793534 nonsense probably null
R1954:Cep170 UTSW 1 176756384 missense probably benign
R1957:Cep170 UTSW 1 176769447 missense probably benign 0.24
R2184:Cep170 UTSW 1 176756976 missense probably benign 0.00
R2280:Cep170 UTSW 1 176774505 missense probably benign 0.17
R2426:Cep170 UTSW 1 176774635 missense probably benign
R3415:Cep170 UTSW 1 176756044 missense probably damaging 1.00
R3417:Cep170 UTSW 1 176756044 missense probably damaging 1.00
R3752:Cep170 UTSW 1 176782495 critical splice donor site probably benign
R3848:Cep170 UTSW 1 176755843 missense probably benign 0.14
R3849:Cep170 UTSW 1 176755843 missense probably benign 0.14
R4752:Cep170 UTSW 1 176756688 missense probably benign 0.00
R4910:Cep170 UTSW 1 176782263 missense possibly damaging 0.94
R5007:Cep170 UTSW 1 176769814 missense probably benign 0.28
R5093:Cep170 UTSW 1 176769330 missense possibly damaging 0.95
R5530:Cep170 UTSW 1 176769510 missense probably benign 0.00
R5622:Cep170 UTSW 1 176735867 missense possibly damaging 0.64
R5892:Cep170 UTSW 1 176755387 unclassified probably null
R5942:Cep170 UTSW 1 176756419 missense probably damaging 1.00
R6083:Cep170 UTSW 1 176774625 missense probably damaging 1.00
R6091:Cep170 UTSW 1 176755831 missense probably damaging 0.98
R6190:Cep170 UTSW 1 176782409 missense probably damaging 1.00
R6253:Cep170 UTSW 1 176780394 missense possibly damaging 0.71
R6476:Cep170 UTSW 1 176780351 missense possibly damaging 0.72
R6622:Cep170 UTSW 1 176756332 missense probably damaging 1.00
R6932:Cep170 UTSW 1 176761437 missense possibly damaging 0.90
R7030:Cep170 UTSW 1 176756485 missense probably damaging 0.99
R7163:Cep170 UTSW 1 176774465 missense probably damaging 1.00
R7352:Cep170 UTSW 1 176769857 missense probably benign 0.11
R7499:Cep170 UTSW 1 176774462 missense probably damaging 1.00
R7502:Cep170 UTSW 1 176756029 missense probably damaging 1.00
R7773:Cep170 UTSW 1 176740076 missense
R8043:Cep170 UTSW 1 176769242 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ACTGACATGAGAGTTAGGTTAGC -3'
(R):5'- TCTAGATTCTGACACTGATGAGAG -3'

Sequencing Primer
(F):5'- TAGGTTAGCAAGAAAATGTAAGTCTG -3'
(R):5'- AAAGGTTGAGGGCAGTTCTG -3'
Posted On2016-06-15