Incidental Mutation 'R5052:P2rx3'
ID394681
Institutional Source Beutler Lab
Gene Symbol P2rx3
Ensembl Gene ENSMUSG00000027071
Gene Namepurinergic receptor P2X, ligand-gated ion channel, 3
Synonyms4930513E20Rik, P2X3
MMRRC Submission 042642-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R5052 (G1)
Quality Score196
Status Validated
Chromosome2
Chromosomal Location84998583-85037462 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 84999024 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 371 (I371L)
Ref Sequence ENSEMBL: ENSMUSP00000107243 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028465] [ENSMUST00000111613] [ENSMUST00000111616]
Predicted Effect probably benign
Transcript: ENSMUST00000028465
AA Change: I395L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000028465
Gene: ENSMUSG00000027071
AA Change: I395L

DomainStartEndE-ValueType
Pfam:P2X_receptor 8 367 1.6e-151 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111613
AA Change: I393L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000107240
Gene: ENSMUSG00000027071
AA Change: I393L

DomainStartEndE-ValueType
Pfam:P2X_receptor 8 372 4.7e-162 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111616
AA Change: I371L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000107243
Gene: ENSMUSG00000027071
AA Change: I371L

DomainStartEndE-ValueType
Pfam:P2X_receptor 8 91 1.2e-32 PFAM
Pfam:P2X_receptor 86 350 3.3e-113 PFAM
Meta Mutation Damage Score 0.0596 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.0%
  • 10x: 94.8%
  • 20x: 86.2%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the family of purinoceptors for ATP. This receptor functions as a ligand-gated ion channel and may transduce ATP-evoked nociceptor activation. Mouse studies suggest that this receptor is important for peripheral pain responses, and also participates in pathways controlling urinary bladder volume reflexes. It is possible that the development of selective antagonists for this receptor may have a therapeutic potential in pain relief and in the treatment of disorders of urine storage. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show normal ventilatory responses to hypoxia. Mice homozygous for a reporter allele show loss of rapidly desensitizing ATP-gated cation currents in dorsal root ganglion neurons, reduced formalin-evoked pain behavior, and enhanced thermal hyperalgesia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd3 A T 3: 121,769,513 probably null Het
Adgrv1 T C 13: 81,528,821 T1964A probably damaging Het
Agbl5 C T 5: 30,891,214 T210I possibly damaging Het
Ak5 T C 3: 152,660,567 T66A probably benign Het
Aktip G A 8: 91,129,651 T66I possibly damaging Het
Aldh1l2 T C 10: 83,508,692 Y330C possibly damaging Het
Btbd19 T G 4: 117,122,257 K122Q possibly damaging Het
Cd180 A G 13: 102,704,895 T150A probably benign Het
Celsr2 A G 3: 108,412,358 I1046T probably damaging Het
Cep170 C T 1: 176,793,551 R20Q probably damaging Het
Cercam T A 2: 29,875,627 N260K probably damaging Het
Cfh T A 1: 140,144,044 H284L probably damaging Het
Chmp5 A G 4: 40,948,608 M1V probably null Het
Elp3 A T 14: 65,577,940 I220N probably damaging Het
Esyt2 A G 12: 116,367,796 T765A probably damaging Het
Evi5l T C 8: 4,206,019 probably benign Het
Gm5866 T G 5: 52,582,892 noncoding transcript Het
Grik1 C A 16: 87,950,098 G417V probably benign Het
Gtpbp1 T G 15: 79,715,969 I399R probably damaging Het
Il17rc T C 6: 113,472,323 C14R probably damaging Het
Ipo9 T C 1: 135,388,611 probably null Het
Kazn G A 4: 142,118,203 probably benign Het
Map3k15 T C X: 159,988,746 V105A possibly damaging Het
Mitf A G 6: 98,010,445 T320A possibly damaging Het
Ncapd3 T G 9: 27,051,719 L440R probably damaging Het
Nrxn2 C G 19: 6,455,204 A359G probably damaging Het
Pde1b C A 15: 103,527,648 Q493K possibly damaging Het
Ptpn13 T C 5: 103,561,980 F1503S probably damaging Het
Ptprz1 T G 6: 23,045,626 W1283G probably damaging Het
Rasd2 T A 8: 75,221,936 D163E possibly damaging Het
Rgs11 A G 17: 26,207,973 probably benign Het
Scap T C 9: 110,353,152 I37T possibly damaging Het
Sgms2 C T 3: 131,330,356 V232M probably benign Het
Slc25a54 A G 3: 109,102,700 I172V probably benign Het
Sympk C T 7: 19,036,042 R215C probably benign Het
Tacc2 T A 7: 130,735,014 D171E probably damaging Het
Tmco4 A G 4: 139,058,506 E629G probably benign Het
Trav7-1 T G 14: 52,655,308 L106R possibly damaging Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Utf1 T C 7: 139,944,901 probably benign Het
Zdhhc13 A G 7: 48,824,731 N577S possibly damaging Het
Zmym6 A G 4: 127,123,974 N1183D possibly damaging Het
Other mutations in P2rx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:P2rx3 APN 2 85035272 missense probably damaging 1.00
IGL01775:P2rx3 APN 2 85024157 missense probably benign
IGL01897:P2rx3 APN 2 85023481 critical splice donor site probably benign
IGL02399:P2rx3 APN 2 85023227 missense probably benign
R0928:P2rx3 UTSW 2 85035298 start codon destroyed probably null 0.98
R1428:P2rx3 UTSW 2 85024950 missense possibly damaging 0.91
R1537:P2rx3 UTSW 2 85023481 critical splice donor site probably null
R1678:P2rx3 UTSW 2 85022467 missense possibly damaging 0.90
R4332:P2rx3 UTSW 2 85024861 missense probably benign 0.25
R4897:P2rx3 UTSW 2 85024926 missense probably damaging 1.00
R5903:P2rx3 UTSW 2 85000727 missense possibly damaging 0.93
R5917:P2rx3 UTSW 2 85035247 missense probably damaging 1.00
R6614:P2rx3 UTSW 2 85035199 missense probably damaging 1.00
Z1177:P2rx3 UTSW 2 85022476
Predicted Primers PCR Primer
(F):5'- GATTCAGGTCTTAGCGGGAAG -3'
(R):5'- AGCTCTAGGTTCCCAGAGAC -3'

Sequencing Primer
(F):5'- AAGCACTGCCTGTCTGCTG -3'
(R):5'- CCACAGCTGATTCTGTCAAATAGGTC -3'
Posted On2016-06-15