Incidental Mutation 'R5052:Kazn'
ID394690
Institutional Source Beutler Lab
Gene Symbol Kazn
Ensembl Gene ENSMUSG00000040606
Gene Namekazrin, periplakin interacting protein
Synonyms
MMRRC Submission 042642-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock #R5052 (G1)
Quality Score128
Status Validated
Chromosome4
Chromosomal Location142102390-142239401 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to A at 142118203 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135922
Predicted Effect unknown
Transcript: ENSMUST00000155023
AA Change: H357Y
SMART Domains Protein: ENSMUSP00000116071
Gene: ENSMUSG00000040606
AA Change: H357Y

DomainStartEndE-ValueType
coiled coil region 1 180 N/A INTRINSIC
low complexity region 299 306 N/A INTRINSIC
SAM 367 435 6.32e-6 SMART
SAM 444 512 4.17e-6 SMART
SAM 533 602 3.37e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173068
SMART Domains Protein: ENSMUSP00000134498
Gene: ENSMUSG00000040606

DomainStartEndE-ValueType
coiled coil region 1 74 N/A INTRINSIC
low complexity region 194 201 N/A INTRINSIC
Meta Mutation Damage Score 0.2081 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.0%
  • 10x: 94.8%
  • 20x: 86.2%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that plays a role in desmosome assembly, cell adhesion, cytoskeletal organization, and epidermal differentiation. This protein co-localizes with desmoplakin and the cytolinker protein periplakin. In general, this protein localizes to the nucleus, desmosomes, cell membrane, and cortical actin-based structures. Some isoforms of this protein also associate with microtubules. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Additional splice variants have been described but their biological validity has not been verified. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous null mice are viable, fertile and grossly normal with no obvious defects in skin development or homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd3 A T 3: 121,769,513 probably null Het
Adgrv1 T C 13: 81,528,821 T1964A probably damaging Het
Agbl5 C T 5: 30,891,214 T210I possibly damaging Het
Ak5 T C 3: 152,660,567 T66A probably benign Het
Aktip G A 8: 91,129,651 T66I possibly damaging Het
Aldh1l2 T C 10: 83,508,692 Y330C possibly damaging Het
Btbd19 T G 4: 117,122,257 K122Q possibly damaging Het
Cd180 A G 13: 102,704,895 T150A probably benign Het
Celsr2 A G 3: 108,412,358 I1046T probably damaging Het
Cep170 C T 1: 176,793,551 R20Q probably damaging Het
Cercam T A 2: 29,875,627 N260K probably damaging Het
Cfh T A 1: 140,144,044 H284L probably damaging Het
Chmp5 A G 4: 40,948,608 M1V probably null Het
Elp3 A T 14: 65,577,940 I220N probably damaging Het
Esyt2 A G 12: 116,367,796 T765A probably damaging Het
Evi5l T C 8: 4,206,019 probably benign Het
Gm5866 T G 5: 52,582,892 noncoding transcript Het
Grik1 C A 16: 87,950,098 G417V probably benign Het
Gtpbp1 T G 15: 79,715,969 I399R probably damaging Het
Il17rc T C 6: 113,472,323 C14R probably damaging Het
Ipo9 T C 1: 135,388,611 probably null Het
Map3k15 T C X: 159,988,746 V105A possibly damaging Het
Mitf A G 6: 98,010,445 T320A possibly damaging Het
Ncapd3 T G 9: 27,051,719 L440R probably damaging Het
Nrxn2 C G 19: 6,455,204 A359G probably damaging Het
P2rx3 T G 2: 84,999,024 I371L probably benign Het
Pde1b C A 15: 103,527,648 Q493K possibly damaging Het
Ptpn13 T C 5: 103,561,980 F1503S probably damaging Het
Ptprz1 T G 6: 23,045,626 W1283G probably damaging Het
Rasd2 T A 8: 75,221,936 D163E possibly damaging Het
Rgs11 A G 17: 26,207,973 probably benign Het
Scap T C 9: 110,353,152 I37T possibly damaging Het
Sgms2 C T 3: 131,330,356 V232M probably benign Het
Slc25a54 A G 3: 109,102,700 I172V probably benign Het
Sympk C T 7: 19,036,042 R215C probably benign Het
Tacc2 T A 7: 130,735,014 D171E probably damaging Het
Tmco4 A G 4: 139,058,506 E629G probably benign Het
Trav7-1 T G 14: 52,655,308 L106R possibly damaging Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Utf1 T C 7: 139,944,901 probably benign Het
Zdhhc13 A G 7: 48,824,731 N577S possibly damaging Het
Zmym6 A G 4: 127,123,974 N1183D possibly damaging Het
Other mutations in Kazn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01721:Kazn APN 4 142159043 critical splice donor site probably null
IGL01959:Kazn APN 4 142150884 missense probably damaging 1.00
IGL02237:Kazn APN 4 142147099 missense probably benign 0.31
IGL02351:Kazn APN 4 142147016 critical splice donor site probably null
IGL02358:Kazn APN 4 142147016 critical splice donor site probably null
R1173:Kazn UTSW 4 142159038 splice site probably benign
R2206:Kazn UTSW 4 142118292 splice site probably null
R3406:Kazn UTSW 4 142239195 start gained probably benign
R4007:Kazn UTSW 4 142106892 missense unknown
R4050:Kazn UTSW 4 142106904 missense unknown
R4598:Kazn UTSW 4 142210092 missense possibly damaging 0.53
R4606:Kazn UTSW 4 142118288 splice site probably null
R4631:Kazn UTSW 4 142118160 unclassified probably benign
R4866:Kazn UTSW 4 142104905 missense unknown
R5050:Kazn UTSW 4 142118203 unclassified probably benign
R5054:Kazn UTSW 4 142108646 missense unknown
R5758:Kazn UTSW 4 142141671 critical splice donor site probably null
R6152:Kazn UTSW 4 142109287 missense unknown
R6284:Kazn UTSW 4 142117197 missense probably benign 0.04
R7289:Kazn UTSW 4 142117175 missense
R7414:Kazn UTSW 4 142109338 missense
R7663:Kazn UTSW 4 142104898 missense
R7814:Kazn UTSW 4 142210170 missense unknown
R8031:Kazn UTSW 4 142154551 missense
R8184:Kazn UTSW 4 142118130 missense probably benign 0.04
R8315:Kazn UTSW 4 142141691 missense
Z1177:Kazn UTSW 4 142154504 missense
Predicted Primers PCR Primer
(F):5'- TGGGTATAACAGTCCCAGGAGG -3'
(R):5'- CTCTTTGGGGAAGCAGAGAG -3'

Sequencing Primer
(F):5'- CAGGAGGGTTCAGAGGCATACC -3'
(R):5'- GTACCAGGAGAGCCACTTTG -3'
Posted On2016-06-15