Incidental Mutation 'R5052:Mitf'
ID394695
Institutional Source Beutler Lab
Gene Symbol Mitf
Ensembl Gene ENSMUSG00000035158
Gene Namemelanogenesis associated transcription factor
Synonymswh, mi, Gsfbcc2, bHLHe32, BCC2
MMRRC Submission 042642-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.901) question?
Stock #R5052 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location97807052-98021349 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 98010445 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 320 (T320A)
Ref Sequence ENSEMBL: ENSMUSP00000098683 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043628] [ENSMUST00000043637] [ENSMUST00000101123] [ENSMUST00000113339] [ENSMUST00000139462] [ENSMUST00000203884] [ENSMUST00000203938]
Predicted Effect possibly damaging
Transcript: ENSMUST00000043628
AA Change: T229A

PolyPhen 2 Score 0.812 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000044459
Gene: ENSMUSG00000035158
AA Change: T229A

DomainStartEndE-ValueType
HLH 210 263 5.53e-17 SMART
Pfam:DUF3371 290 416 9.5e-47 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000043637
AA Change: T336A

PolyPhen 2 Score 0.814 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000044938
Gene: ENSMUSG00000035158
AA Change: T336A

DomainStartEndE-ValueType
low complexity region 34 44 N/A INTRINSIC
Pfam:MITF_TFEB_C_3_N 56 228 3.1e-52 PFAM
HLH 317 370 5.53e-17 SMART
Pfam:DUF3371 397 522 2.7e-38 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000101123
AA Change: T320A

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000098683
Gene: ENSMUSG00000035158
AA Change: T320A

DomainStartEndE-ValueType
coiled coil region 44 74 N/A INTRINSIC
HLH 301 354 5.53e-17 SMART
Pfam:DUF3371 381 507 4.8e-47 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000113339
AA Change: T311A

PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000108965
Gene: ENSMUSG00000035158
AA Change: T311A

DomainStartEndE-ValueType
coiled coil region 35 65 N/A INTRINSIC
HLH 292 345 5.53e-17 SMART
Pfam:DUF3371 372 498 4.6e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139462
Predicted Effect possibly damaging
Transcript: ENSMUST00000203884
AA Change: T330A

PolyPhen 2 Score 0.777 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000145132
Gene: ENSMUSG00000035158
AA Change: T330A

DomainStartEndE-ValueType
low complexity region 34 44 N/A INTRINSIC
Pfam:MITF_TFEB_C_3_N 56 228 2.2e-49 PFAM
HLH 311 364 2.3e-19 SMART
Pfam:DUF3371 391 516 1.9e-35 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000203938
AA Change: T167A

PolyPhen 2 Score 0.814 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000144988
Gene: ENSMUSG00000035158
AA Change: T167A

DomainStartEndE-ValueType
Pfam:MITF_TFEB_C_3_N 7 60 2.2e-7 PFAM
HLH 148 201 2.3e-19 SMART
Pfam:DUF3371 228 353 9.2e-36 PFAM
Meta Mutation Damage Score 0.0819 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.0%
  • 10x: 94.8%
  • 20x: 86.2%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: This transcription factor serves at a critical point between extracellular signaling and downstream targets in cell specification in early eye and neural crest development. Mutant alleles have been identified that generate distinct phenotypes. Some of these alleles are being used to model the human diseases Waardenburg syndrome IIa and Tietz syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations at this locus affect development of melanocytes, mast cells, osteoclasts and pigmented epithelium. Mutants variably display lack of pigment in coat and eye, microphthalmia, hearing loss, bone resorption anomalies, mast cell deficiency and lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd3 A T 3: 121,769,513 probably null Het
Adgrv1 T C 13: 81,528,821 T1964A probably damaging Het
Agbl5 C T 5: 30,891,214 T210I possibly damaging Het
Ak5 T C 3: 152,660,567 T66A probably benign Het
Aktip G A 8: 91,129,651 T66I possibly damaging Het
Aldh1l2 T C 10: 83,508,692 Y330C possibly damaging Het
Btbd19 T G 4: 117,122,257 K122Q possibly damaging Het
Cd180 A G 13: 102,704,895 T150A probably benign Het
Celsr2 A G 3: 108,412,358 I1046T probably damaging Het
Cep170 C T 1: 176,793,551 R20Q probably damaging Het
Cercam T A 2: 29,875,627 N260K probably damaging Het
Cfh T A 1: 140,144,044 H284L probably damaging Het
Chmp5 A G 4: 40,948,608 M1V probably null Het
Elp3 A T 14: 65,577,940 I220N probably damaging Het
Esyt2 A G 12: 116,367,796 T765A probably damaging Het
Evi5l T C 8: 4,206,019 probably benign Het
Gm5866 T G 5: 52,582,892 noncoding transcript Het
Grik1 C A 16: 87,950,098 G417V probably benign Het
Gtpbp1 T G 15: 79,715,969 I399R probably damaging Het
Il17rc T C 6: 113,472,323 C14R probably damaging Het
Ipo9 T C 1: 135,388,611 probably null Het
Kazn G A 4: 142,118,203 probably benign Het
Map3k15 T C X: 159,988,746 V105A possibly damaging Het
Ncapd3 T G 9: 27,051,719 L440R probably damaging Het
Nrxn2 C G 19: 6,455,204 A359G probably damaging Het
P2rx3 T G 2: 84,999,024 I371L probably benign Het
Pde1b C A 15: 103,527,648 Q493K possibly damaging Het
Ptpn13 T C 5: 103,561,980 F1503S probably damaging Het
Ptprz1 T G 6: 23,045,626 W1283G probably damaging Het
Rasd2 T A 8: 75,221,936 D163E possibly damaging Het
Rgs11 A G 17: 26,207,973 probably benign Het
Scap T C 9: 110,353,152 I37T possibly damaging Het
Sgms2 C T 3: 131,330,356 V232M probably benign Het
Slc25a54 A G 3: 109,102,700 I172V probably benign Het
Sympk C T 7: 19,036,042 R215C probably benign Het
Tacc2 T A 7: 130,735,014 D171E probably damaging Het
Tmco4 A G 4: 139,058,506 E629G probably benign Het
Trav7-1 T G 14: 52,655,308 L106R possibly damaging Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Utf1 T C 7: 139,944,901 probably benign Het
Zdhhc13 A G 7: 48,824,731 N577S possibly damaging Het
Zmym6 A G 4: 127,123,974 N1183D possibly damaging Het
Other mutations in Mitf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01407:Mitf APN 6 98017931 missense possibly damaging 0.69
IGL01516:Mitf APN 6 98010390 splice site probably null
IGL01617:Mitf APN 6 97996428 missense probably benign 0.00
IGL01875:Mitf APN 6 98017895 missense probably benign 0.22
R0010:Mitf UTSW 6 97807281 missense probably benign 0.25
R0010:Mitf UTSW 6 97807281 missense probably benign 0.25
R0079:Mitf UTSW 6 97996440 missense probably benign 0.00
R0381:Mitf UTSW 6 97993143 missense probably damaging 1.00
R0494:Mitf UTSW 6 97994429 missense probably benign 0.00
R0633:Mitf UTSW 6 98003904 missense probably damaging 0.98
R0829:Mitf UTSW 6 98003908 missense possibly damaging 0.46
R1189:Mitf UTSW 6 98006125 missense possibly damaging 0.67
R1459:Mitf UTSW 6 98010467 missense probably damaging 1.00
R1766:Mitf UTSW 6 97941099 missense probably damaging 1.00
R1864:Mitf UTSW 6 98010422 missense probably damaging 1.00
R1891:Mitf UTSW 6 97941276 missense probably benign 0.00
R3934:Mitf UTSW 6 97993253 missense probably damaging 1.00
R3936:Mitf UTSW 6 97993253 missense probably damaging 1.00
R4323:Mitf UTSW 6 97991949 missense probably benign 0.12
R5097:Mitf UTSW 6 97996462 missense possibly damaging 0.63
R5297:Mitf UTSW 6 97994430 missense probably benign 0.09
R5646:Mitf UTSW 6 98013694 missense probably damaging 1.00
R6109:Mitf UTSW 6 97996468 missense probably damaging 1.00
R6351:Mitf UTSW 6 98003912 missense possibly damaging 0.85
R6411:Mitf UTSW 6 98010472 critical splice donor site probably null
R7855:Mitf UTSW 6 97993196 missense probably damaging 1.00
R7904:Mitf UTSW 6 98013710 missense probably damaging 0.99
R7975:Mitf UTSW 6 98018029 missense probably benign 0.17
R8061:Mitf UTSW 6 97993298 missense probably damaging 0.98
Z1177:Mitf UTSW 6 98006121 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CAAGTTTCCATTGTCCTGGC -3'
(R):5'- TGCCCATAAACTCTACTGCC -3'

Sequencing Primer
(F):5'- CTGGCTGGTGACGTCAGTAC -3'
(R):5'- TTCAAAGCTAACTATCTCAGCTCG -3'
Posted On2016-06-15