Incidental Mutation 'R5052:Aldh1l2'
ID 394706
Institutional Source Beutler Lab
Gene Symbol Aldh1l2
Ensembl Gene ENSMUSG00000020256
Gene Name aldehyde dehydrogenase 1 family, member L2
Synonyms D330038I09Rik
MMRRC Submission 042642-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5052 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 83323314-83370004 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 83344556 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 330 (Y330C)
Ref Sequence ENSEMBL: ENSMUSP00000117076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020497] [ENSMUST00000146640]
AlphaFold Q8K009
Predicted Effect possibly damaging
Transcript: ENSMUST00000020497
AA Change: Y443C

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000020497
Gene: ENSMUSG00000020256
AA Change: Y443C

DomainStartEndE-ValueType
Pfam:Formyl_trans_N 23 202 5e-46 PFAM
Pfam:Formyl_trans_C 226 330 1.3e-16 PFAM
Pfam:PP-binding 346 412 9.6e-7 PFAM
Pfam:Aldedh 451 919 3.4e-174 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125193
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138858
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143793
Predicted Effect possibly damaging
Transcript: ENSMUST00000146640
AA Change: Y330C

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000117076
Gene: ENSMUSG00000020256
AA Change: Y330C

DomainStartEndE-ValueType
Pfam:Formyl_trans_N 1 89 2.8e-30 PFAM
Pfam:Formyl_trans_C 113 217 1.1e-16 PFAM
Pfam:PP-binding 233 299 1.5e-8 PFAM
Pfam:Aldedh 338 806 8.5e-175 PFAM
Meta Mutation Damage Score 0.1763 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.0%
  • 10x: 94.8%
  • 20x: 86.2%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of both the aldehyde dehydrogenase superfamily and the formyl transferase superfamily. This member is the mitochondrial form of 10-formyltetrahydrofolate dehydrogenase (FDH), which converts 10-formyltetrahydrofolate to tetrahydrofolate and CO2 in an NADP(+)-dependent reaction, and plays an essential role in the distribution of one-carbon groups between the cytosolic and mitochondrial compartments of the cell. Alternatively spliced transcript variants have been found for this gene.[provided by RefSeq, Oct 2010]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd3 A T 3: 121,563,162 (GRCm39) probably null Het
Adgrv1 T C 13: 81,676,940 (GRCm39) T1964A probably damaging Het
Agbl5 C T 5: 31,048,558 (GRCm39) T210I possibly damaging Het
Ak5 T C 3: 152,366,204 (GRCm39) T66A probably benign Het
Aktip G A 8: 91,856,279 (GRCm39) T66I possibly damaging Het
Btbd19 T G 4: 116,979,454 (GRCm39) K122Q possibly damaging Het
Cd180 A G 13: 102,841,403 (GRCm39) T150A probably benign Het
Celsr2 A G 3: 108,319,674 (GRCm39) I1046T probably damaging Het
Cep170 C T 1: 176,621,117 (GRCm39) R20Q probably damaging Het
Cercam T A 2: 29,765,639 (GRCm39) N260K probably damaging Het
Cfh T A 1: 140,071,782 (GRCm39) H284L probably damaging Het
Chmp5 A G 4: 40,948,608 (GRCm39) M1V probably null Het
Elp3 A T 14: 65,815,389 (GRCm39) I220N probably damaging Het
Esyt2 A G 12: 116,331,416 (GRCm39) T765A probably damaging Het
Evi5l T C 8: 4,256,019 (GRCm39) probably benign Het
Gm5866 T G 5: 52,740,234 (GRCm39) noncoding transcript Het
Grik1 C A 16: 87,746,986 (GRCm39) G417V probably benign Het
Gtpbp1 T G 15: 79,600,170 (GRCm39) I399R probably damaging Het
Il17rc T C 6: 113,449,284 (GRCm39) C14R probably damaging Het
Ipo9 T C 1: 135,316,349 (GRCm39) probably null Het
Kazn G A 4: 141,845,514 (GRCm39) probably benign Het
Map3k15 T C X: 158,771,742 (GRCm39) V105A possibly damaging Het
Mitf A G 6: 97,987,406 (GRCm39) T320A possibly damaging Het
Ncapd3 T G 9: 26,963,015 (GRCm39) L440R probably damaging Het
Nrxn2 C G 19: 6,505,234 (GRCm39) A359G probably damaging Het
P2rx3 T G 2: 84,829,368 (GRCm39) I371L probably benign Het
Pde1b C A 15: 103,436,075 (GRCm39) Q493K possibly damaging Het
Ptpn13 T C 5: 103,709,846 (GRCm39) F1503S probably damaging Het
Ptprz1 T G 6: 23,045,625 (GRCm39) W1283G probably damaging Het
Rasd2 T A 8: 75,948,564 (GRCm39) D163E possibly damaging Het
Rgs11 A G 17: 26,426,947 (GRCm39) probably benign Het
Scap T C 9: 110,182,220 (GRCm39) I37T possibly damaging Het
Sgms2 C T 3: 131,124,005 (GRCm39) V232M probably benign Het
Slc25a54 A G 3: 109,010,016 (GRCm39) I172V probably benign Het
Sympk C T 7: 18,769,967 (GRCm39) R215C probably benign Het
Tacc2 T A 7: 130,336,744 (GRCm39) D171E probably damaging Het
Tmco4 A G 4: 138,785,817 (GRCm39) E629G probably benign Het
Trav7-1 T G 14: 52,892,765 (GRCm39) L106R possibly damaging Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,139,706 (GRCm39) probably benign Het
Utf1 T C 7: 139,524,814 (GRCm39) probably benign Het
Zdhhc13 A G 7: 48,474,479 (GRCm39) N577S possibly damaging Het
Zmym6 A G 4: 127,017,767 (GRCm39) N1183D possibly damaging Het
Other mutations in Aldh1l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01152:Aldh1l2 APN 10 83,358,750 (GRCm39) nonsense probably null
IGL01154:Aldh1l2 APN 10 83,356,237 (GRCm39) missense probably damaging 1.00
IGL01301:Aldh1l2 APN 10 83,358,710 (GRCm39) missense probably damaging 1.00
IGL01354:Aldh1l2 APN 10 83,363,240 (GRCm39) missense probably damaging 1.00
IGL01364:Aldh1l2 APN 10 83,328,531 (GRCm39) missense probably damaging 1.00
IGL01445:Aldh1l2 APN 10 83,356,126 (GRCm39) splice site probably benign
IGL02179:Aldh1l2 APN 10 83,358,701 (GRCm39) missense probably benign 0.10
IGL02283:Aldh1l2 APN 10 83,331,759 (GRCm39) missense probably benign 0.00
IGL02507:Aldh1l2 APN 10 83,328,448 (GRCm39) nonsense probably null
IGL02727:Aldh1l2 APN 10 83,342,469 (GRCm39) missense probably damaging 1.00
IGL03353:Aldh1l2 APN 10 83,358,777 (GRCm39) missense probably benign 0.17
Hunger_winter UTSW 10 83,343,877 (GRCm39) critical splice donor site probably null
Spartan UTSW 10 83,348,170 (GRCm39) missense possibly damaging 0.93
ANU18:Aldh1l2 UTSW 10 83,358,710 (GRCm39) missense probably damaging 1.00
IGL02984:Aldh1l2 UTSW 10 83,363,199 (GRCm39) missense probably damaging 1.00
R0267:Aldh1l2 UTSW 10 83,358,551 (GRCm39) splice site probably benign
R0302:Aldh1l2 UTSW 10 83,356,229 (GRCm39) missense probably damaging 1.00
R0349:Aldh1l2 UTSW 10 83,326,478 (GRCm39) missense probably damaging 1.00
R0468:Aldh1l2 UTSW 10 83,354,542 (GRCm39) missense probably benign 0.01
R0745:Aldh1l2 UTSW 10 83,354,494 (GRCm39) splice site probably null
R0788:Aldh1l2 UTSW 10 83,352,028 (GRCm39) missense probably damaging 1.00
R1117:Aldh1l2 UTSW 10 83,344,487 (GRCm39) missense probably benign 0.01
R1241:Aldh1l2 UTSW 10 83,331,889 (GRCm39) missense probably benign 0.00
R1420:Aldh1l2 UTSW 10 83,331,799 (GRCm39) missense probably damaging 1.00
R1490:Aldh1l2 UTSW 10 83,356,234 (GRCm39) missense probably damaging 1.00
R1704:Aldh1l2 UTSW 10 83,344,524 (GRCm39) missense probably benign 0.10
R1729:Aldh1l2 UTSW 10 83,343,946 (GRCm39) nonsense probably null
R1893:Aldh1l2 UTSW 10 83,328,400 (GRCm39) missense probably damaging 1.00
R1897:Aldh1l2 UTSW 10 83,338,389 (GRCm39) missense probably damaging 1.00
R2047:Aldh1l2 UTSW 10 83,342,607 (GRCm39) missense probably damaging 1.00
R2290:Aldh1l2 UTSW 10 83,363,177 (GRCm39) missense probably damaging 1.00
R3054:Aldh1l2 UTSW 10 83,338,336 (GRCm39) missense probably benign 0.14
R3055:Aldh1l2 UTSW 10 83,338,336 (GRCm39) missense probably benign 0.14
R4097:Aldh1l2 UTSW 10 83,348,228 (GRCm39) missense probably damaging 0.98
R4162:Aldh1l2 UTSW 10 83,342,518 (GRCm39) missense possibly damaging 0.50
R4295:Aldh1l2 UTSW 10 83,331,784 (GRCm39) missense possibly damaging 0.62
R4296:Aldh1l2 UTSW 10 83,358,641 (GRCm39) missense probably benign 0.34
R4388:Aldh1l2 UTSW 10 83,349,486 (GRCm39) missense probably damaging 1.00
R4809:Aldh1l2 UTSW 10 83,342,496 (GRCm39) missense probably damaging 1.00
R5421:Aldh1l2 UTSW 10 83,363,271 (GRCm39) missense probably damaging 1.00
R5491:Aldh1l2 UTSW 10 83,358,649 (GRCm39) missense probably benign 0.00
R5688:Aldh1l2 UTSW 10 83,337,789 (GRCm39) missense possibly damaging 0.93
R5726:Aldh1l2 UTSW 10 83,348,170 (GRCm39) missense possibly damaging 0.93
R5737:Aldh1l2 UTSW 10 83,356,189 (GRCm39) missense probably damaging 1.00
R5752:Aldh1l2 UTSW 10 83,356,244 (GRCm39) missense probably damaging 1.00
R6113:Aldh1l2 UTSW 10 83,343,998 (GRCm39) nonsense probably null
R6161:Aldh1l2 UTSW 10 83,356,202 (GRCm39) missense probably benign 0.00
R6166:Aldh1l2 UTSW 10 83,329,288 (GRCm39) splice site probably null
R6189:Aldh1l2 UTSW 10 83,343,877 (GRCm39) critical splice donor site probably null
R7357:Aldh1l2 UTSW 10 83,350,408 (GRCm39) missense possibly damaging 0.89
R7394:Aldh1l2 UTSW 10 83,338,321 (GRCm39) missense probably damaging 1.00
R7469:Aldh1l2 UTSW 10 83,343,969 (GRCm39) missense probably damaging 1.00
R7676:Aldh1l2 UTSW 10 83,343,975 (GRCm39) missense probably benign
R7848:Aldh1l2 UTSW 10 83,335,707 (GRCm39) missense probably benign 0.12
R7958:Aldh1l2 UTSW 10 83,356,202 (GRCm39) missense probably benign 0.00
R8311:Aldh1l2 UTSW 10 83,326,479 (GRCm39) missense probably damaging 1.00
R8477:Aldh1l2 UTSW 10 83,337,785 (GRCm39) missense probably damaging 1.00
R8730:Aldh1l2 UTSW 10 83,342,506 (GRCm39) missense possibly damaging 0.94
R8884:Aldh1l2 UTSW 10 83,344,541 (GRCm39) missense probably benign 0.02
R9117:Aldh1l2 UTSW 10 83,342,545 (GRCm39) missense probably benign 0.41
R9239:Aldh1l2 UTSW 10 83,342,496 (GRCm39) missense probably damaging 1.00
R9335:Aldh1l2 UTSW 10 83,342,510 (GRCm39) missense probably damaging 0.96
R9368:Aldh1l2 UTSW 10 83,331,816 (GRCm39) nonsense probably null
R9784:Aldh1l2 UTSW 10 83,342,614 (GRCm39) critical splice acceptor site probably null
Z1177:Aldh1l2 UTSW 10 83,369,869 (GRCm39) missense probably benign
Z1177:Aldh1l2 UTSW 10 83,329,344 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTAGTGTCAGAGCTGAGTG -3'
(R):5'- AGCTGACCTCTTTCCACATTAGTG -3'

Sequencing Primer
(F):5'- CTAGTGTCAGAGCTGAGTGGGTAAG -3'
(R):5'- GGTCAGTATATGTCACCAGATGCC -3'
Posted On 2016-06-15