Mutagenetix > Incidental Mutation

Incidental Mutation 'R5052:Aldh1l2'

394706

Institutional Source

Beutler Lab

Gene Symbol

Aldh1l2

Ensembl Gene

ENSMUSG00000020256

Gene Name

aldehyde dehydrogenase 1 family, member L2

Synonyms

MMRRC Submission

042642-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5052 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

83487450-83534140 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 83508692 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 330 (Y330C)

Ref Sequence

ENSEMBL: ENSMUSP00000117076 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020497] [ENSMUST00000146640]

AlphaFold

Q8K009

Predicted Effect

possibly damaging
Transcript: ENSMUST00000020497
AA Change: Y443C

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000020497
Gene: ENSMUSG00000020256
AA Change: Y443C

Domain	Start	End	E-Value	Type
Pfam:Formyl_trans_N	23	202	5e-46	PFAM
Pfam:Formyl_trans_C	226	330	1.3e-16	PFAM
Pfam:PP-binding	346	412	9.6e-7	PFAM
Pfam:Aldedh	451	919	3.4e-174	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125193

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138858

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143793

Predicted Effect

possibly damaging
Transcript: ENSMUST00000146640
AA Change: Y330C

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000117076
Gene: ENSMUSG00000020256
AA Change: Y330C

Domain	Start	End	E-Value	Type
Pfam:Formyl_trans_N	1	89	2.8e-30	PFAM
Pfam:Formyl_trans_C	113	217	1.1e-16	PFAM
Pfam:PP-binding	233	299	1.5e-8	PFAM
Pfam:Aldedh	338	806	8.5e-175	PFAM

Meta Mutation Damage Score

0.1763

Coding Region Coverage

1x: 99.1%
3x: 98.0%
10x: 94.8%
20x: 86.2%

Validation Efficiency

100% (58/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of both the aldehyde dehydrogenase superfamily and the formyl transferase superfamily. This member is the mitochondrial form of 10-formyltetrahydrofolate dehydrogenase (FDH), which converts 10-formyltetrahydrofolate to tetrahydrofolate and CO2 in an NADP(+)-dependent reaction, and plays an essential role in the distribution of one-carbon groups between the cytosolic and mitochondrial compartments of the cell. Alternatively spliced transcript variants have been found for this gene.[provided by RefSeq, Oct 2010]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcd3	A	T	3: 121,769,513		probably null	Het
Adgrv1	T	C	13: 81,528,821	T1964A	probably damaging	Het
Agbl5	C	T	5: 30,891,214	T210I	possibly damaging	Het
Ak5	T	C	3: 152,660,567	T66A	probably benign	Het
Aktip	G	A	8: 91,129,651	T66I	possibly damaging	Het
Btbd19	T	G	4: 117,122,257	K122Q	possibly damaging	Het
Cd180	A	G	13: 102,704,895	T150A	probably benign	Het
Celsr2	A	G	3: 108,412,358	I1046T	probably damaging	Het
Cep170	C	T	1: 176,793,551	R20Q	probably damaging	Het
Cercam	T	A	2: 29,875,627	N260K	probably damaging	Het
Cfh	T	A	1: 140,144,044	H284L	probably damaging	Het
Chmp5	A	G	4: 40,948,608	M1V	probably null	Het
Elp3	A	T	14: 65,577,940	I220N	probably damaging	Het
Esyt2	A	G	12: 116,367,796	T765A	probably damaging	Het
Evi5l	T	C	8: 4,206,019		probably benign	Het
Gm5866	T	G	5: 52,582,892		noncoding transcript	Het
Grik1	C	A	16: 87,950,098	G417V	probably benign	Het
Gtpbp1	T	G	15: 79,715,969	I399R	probably damaging	Het
Il17rc	T	C	6: 113,472,323	C14R	probably damaging	Het
Ipo9	T	C	1: 135,388,611		probably null	Het
Kazn	G	A	4: 142,118,203		probably benign	Het
Map3k15	T	C	X: 159,988,746	V105A	possibly damaging	Het
Mitf	A	G	6: 98,010,445	T320A	possibly damaging	Het
Ncapd3	T	G	9: 27,051,719	L440R	probably damaging	Het
Nrxn2	C	G	19: 6,455,204	A359G	probably damaging	Het
P2rx3	T	G	2: 84,999,024	I371L	probably benign	Het
Pde1b	C	A	15: 103,527,648	Q493K	possibly damaging	Het
Ptpn13	T	C	5: 103,561,980	F1503S	probably damaging	Het
Ptprz1	T	G	6: 23,045,626	W1283G	probably damaging	Het
Rasd2	T	A	8: 75,221,936	D163E	possibly damaging	Het
Rgs11	A	G	17: 26,207,973		probably benign	Het
Scap	T	C	9: 110,353,152	I37T	possibly damaging	Het
Sgms2	C	T	3: 131,330,356	V232M	probably benign	Het
Slc25a54	A	G	3: 109,102,700	I172V	probably benign	Het
Sympk	C	T	7: 19,036,042	R215C	probably benign	Het
Tacc2	T	A	7: 130,735,014	D171E	probably damaging	Het
Tmco4	A	G	4: 139,058,506	E629G	probably benign	Het
Trav7-1	T	G	14: 52,655,308	L106R	possibly damaging	Het
Ugt1a1	CAGAGAGAGAGAGA	CAGAGAGAGAGA	1: 88,211,984		probably benign	Het
Utf1	T	C	7: 139,944,901		probably benign	Het
Zdhhc13	A	G	7: 48,824,731	N577S	possibly damaging	Het
Zmym6	A	G	4: 127,123,974	N1183D	possibly damaging	Het

Other mutations in Aldh1l2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01152:Aldh1l2	APN	10	83522886	nonsense	probably null
IGL01154:Aldh1l2	APN	10	83520373	missense	probably damaging	1.00
IGL01301:Aldh1l2	APN	10	83522846	missense	probably damaging	1.00
IGL01354:Aldh1l2	APN	10	83527376	missense	probably damaging	1.00
IGL01364:Aldh1l2	APN	10	83492667	missense	probably damaging	1.00
IGL01445:Aldh1l2	APN	10	83520262	splice site	probably benign
IGL02179:Aldh1l2	APN	10	83522837	missense	probably benign	0.10
IGL02283:Aldh1l2	APN	10	83495895	missense	probably benign	0.00
IGL02507:Aldh1l2	APN	10	83492584	nonsense	probably null
IGL02727:Aldh1l2	APN	10	83506605	missense	probably damaging	1.00
IGL03353:Aldh1l2	APN	10	83522913	missense	probably benign	0.17
Hunger_winter	UTSW	10	83508013	critical splice donor site	probably null
Spartan	UTSW	10	83512306	missense	possibly damaging	0.93
ANU18:Aldh1l2	UTSW	10	83522846	missense	probably damaging	1.00
IGL02984:Aldh1l2	UTSW	10	83527335	missense	probably damaging	1.00
R0267:Aldh1l2	UTSW	10	83522687	splice site	probably benign
R0302:Aldh1l2	UTSW	10	83520365	missense	probably damaging	1.00
R0349:Aldh1l2	UTSW	10	83490614	missense	probably damaging	1.00
R0468:Aldh1l2	UTSW	10	83518678	missense	probably benign	0.01
R0745:Aldh1l2	UTSW	10	83518630	splice site	probably null
R0788:Aldh1l2	UTSW	10	83516164	missense	probably damaging	1.00
R1117:Aldh1l2	UTSW	10	83508623	missense	probably benign	0.01
R1241:Aldh1l2	UTSW	10	83496025	missense	probably benign	0.00
R1420:Aldh1l2	UTSW	10	83495935	missense	probably damaging	1.00
R1490:Aldh1l2	UTSW	10	83520370	missense	probably damaging	1.00
R1704:Aldh1l2	UTSW	10	83508660	missense	probably benign	0.10
R1729:Aldh1l2	UTSW	10	83508082	nonsense	probably null
R1893:Aldh1l2	UTSW	10	83492536	missense	probably damaging	1.00
R1897:Aldh1l2	UTSW	10	83502525	missense	probably damaging	1.00
R2047:Aldh1l2	UTSW	10	83506743	missense	probably damaging	1.00
R2290:Aldh1l2	UTSW	10	83527313	missense	probably damaging	1.00
R3054:Aldh1l2	UTSW	10	83502472	missense	probably benign	0.14
R3055:Aldh1l2	UTSW	10	83502472	missense	probably benign	0.14
R4097:Aldh1l2	UTSW	10	83512364	missense	probably damaging	0.98
R4162:Aldh1l2	UTSW	10	83506654	missense	possibly damaging	0.50
R4295:Aldh1l2	UTSW	10	83495920	missense	possibly damaging	0.62
R4296:Aldh1l2	UTSW	10	83522777	missense	probably benign	0.34
R4388:Aldh1l2	UTSW	10	83513622	missense	probably damaging	1.00
R4809:Aldh1l2	UTSW	10	83506632	missense	probably damaging	1.00
R5421:Aldh1l2	UTSW	10	83527407	missense	probably damaging	1.00
R5491:Aldh1l2	UTSW	10	83522785	missense	probably benign	0.00
R5688:Aldh1l2	UTSW	10	83501925	missense	possibly damaging	0.93
R5726:Aldh1l2	UTSW	10	83512306	missense	possibly damaging	0.93
R5737:Aldh1l2	UTSW	10	83520325	missense	probably damaging	1.00
R5752:Aldh1l2	UTSW	10	83520380	missense	probably damaging	1.00
R6113:Aldh1l2	UTSW	10	83508134	nonsense	probably null
R6161:Aldh1l2	UTSW	10	83520338	missense	probably benign	0.00
R6166:Aldh1l2	UTSW	10	83493424	splice site	probably null
R6189:Aldh1l2	UTSW	10	83508013	critical splice donor site	probably null
R7357:Aldh1l2	UTSW	10	83514544	missense	possibly damaging	0.89
R7394:Aldh1l2	UTSW	10	83502457	missense	probably damaging	1.00
R7469:Aldh1l2	UTSW	10	83508105	missense	probably damaging	1.00
R7676:Aldh1l2	UTSW	10	83508111	missense	probably benign
R7848:Aldh1l2	UTSW	10	83499843	missense	probably benign	0.12
R7958:Aldh1l2	UTSW	10	83520338	missense	probably benign	0.00
R8311:Aldh1l2	UTSW	10	83490615	missense	probably damaging	1.00
R8477:Aldh1l2	UTSW	10	83501921	missense	probably damaging	1.00
R8730:Aldh1l2	UTSW	10	83506642	missense	possibly damaging	0.94
R8884:Aldh1l2	UTSW	10	83508677	missense	probably benign	0.02
R9117:Aldh1l2	UTSW	10	83506681	missense	probably benign	0.41
R9239:Aldh1l2	UTSW	10	83506632	missense	probably damaging	1.00
R9335:Aldh1l2	UTSW	10	83506646	missense	probably damaging	0.96
R9368:Aldh1l2	UTSW	10	83495952	nonsense	probably null
R9784:Aldh1l2	UTSW	10	83506750	critical splice acceptor site	probably null
Z1177:Aldh1l2	UTSW	10	83493480	missense	probably damaging	1.00
Z1177:Aldh1l2	UTSW	10	83534005	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GCTAGTGTCAGAGCTGAGTG -3'
(R):5'- AGCTGACCTCTTTCCACATTAGTG -3'

Sequencing Primer
(F):5'- CTAGTGTCAGAGCTGAGTGGGTAAG -3'
(R):5'- GGTCAGTATATGTCACCAGATGCC -3'

Posted On

2016-06-15