Mutagenetix > Incidental Mutations

Incidental Mutation 'R5052:Cd180'

394709

Institutional Source

Beutler Lab

Gene Symbol

Cd180

Ensembl Gene

ENSMUSG00000021624

Gene Name

CD180 antigen

Synonyms

Ly78, RP105

MMRRC Submission

042642-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5052 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

102693558-102739629 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 102704895 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 150 (T150A)

Ref Sequence

ENSEMBL: ENSMUSP00000022124 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022124] [ENSMUST00000167144] [ENSMUST00000170878] [ENSMUST00000171267] [ENSMUST00000172138]

PDB Structure

Crystal structure of mouse RP105/MD-1 complex [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000022124
AA Change: T150A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000022124
Gene: ENSMUSG00000021624
AA Change: T150A

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
LRR	76	99	1.07e0	SMART
LRR	193	221	1.76e2	SMART
LRR	297	320	1.66e1	SMART
Pfam:LRR_8	321	382	4.2e-13	PFAM
LRR	395	418	3e1	SMART
LRR	444	467	3.09e1	SMART
LRR	495	518	4.97e0	SMART
LRR	519	542	2.4e1	SMART
low complexity region	555	567	N/A	INTRINSIC
LRRCT	577	626	5.11e-8	SMART
transmembrane domain	628	650	N/A	INTRINSIC

Predicted Effect

silent
Transcript: ENSMUST00000167144

SMART Domains

Protein: ENSMUSP00000133015
Gene: ENSMUSG00000021624

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000170878

SMART Domains

Protein: ENSMUSP00000127880
Gene: ENSMUSG00000021624

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
PDB:3T6Q\|B	21	86	3e-38	PDB
SCOP:d1m0za_	35	84	4e-4	SMART
Blast:LRR	51	75	1e-5	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000171267

SMART Domains

Protein: ENSMUSP00000129096
Gene: ENSMUSG00000021624

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
PDB:3T6Q\|B	21	86	2e-38	PDB
SCOP:d1m0za_	35	84	9e-4	SMART
Blast:LRR	51	75	7e-6	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000172138

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.0%
10x: 94.8%
20x: 86.2%

Validation Efficiency

100% (58/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CD180 is a cell surface molecule consisting of extracellular leucine-rich repeats (LRR) and a short cytoplasmic tail. The extracellular LRR is associated with a molecule called MD-1 and form the cell surface receptor complex, RP105/MD-1. It belongs to the family of pathogen receptors, Toll-like receptors (TLR). RP105/MD1, by working in concert with TLR4, controls B cell recognition and signaling of lipopolysaccharide (LPS), a membrane constituent of Gram-negative bacteria. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation showed impaired proliferative and humoral immune responses of B cells to lipopolysaccharides. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcd3	A	T	3: 121,769,513		probably null	Het
Adgrv1	T	C	13: 81,528,821	T1964A	probably damaging	Het
Agbl5	C	T	5: 30,891,214	T210I	possibly damaging	Het
Ak5	T	C	3: 152,660,567	T66A	probably benign	Het
Aktip	G	A	8: 91,129,651	T66I	possibly damaging	Het
Aldh1l2	T	C	10: 83,508,692	Y330C	possibly damaging	Het
Btbd19	T	G	4: 117,122,257	K122Q	possibly damaging	Het
Celsr2	A	G	3: 108,412,358	I1046T	probably damaging	Het
Cep170	C	T	1: 176,793,551	R20Q	probably damaging	Het
Cercam	T	A	2: 29,875,627	N260K	probably damaging	Het
Cfh	T	A	1: 140,144,044	H284L	probably damaging	Het
Chmp5	A	G	4: 40,948,608	M1V	probably null	Het
Elp3	A	T	14: 65,577,940	I220N	probably damaging	Het
Esyt2	A	G	12: 116,367,796	T765A	probably damaging	Het
Evi5l	T	C	8: 4,206,019		probably benign	Het
Gm5866	T	G	5: 52,582,892		noncoding transcript	Het
Grik1	C	A	16: 87,950,098	G417V	probably benign	Het
Gtpbp1	T	G	15: 79,715,969	I399R	probably damaging	Het
Il17rc	T	C	6: 113,472,323	C14R	probably damaging	Het
Ipo9	T	C	1: 135,388,611		probably null	Het
Kazn	G	A	4: 142,118,203		probably benign	Het
Map3k15	T	C	X: 159,988,746	V105A	possibly damaging	Het
Mitf	A	G	6: 98,010,445	T320A	possibly damaging	Het
Ncapd3	T	G	9: 27,051,719	L440R	probably damaging	Het
Nrxn2	C	G	19: 6,455,204	A359G	probably damaging	Het
P2rx3	T	G	2: 84,999,024	I371L	probably benign	Het
Pde1b	C	A	15: 103,527,648	Q493K	possibly damaging	Het
Ptpn13	T	C	5: 103,561,980	F1503S	probably damaging	Het
Ptprz1	T	G	6: 23,045,626	W1283G	probably damaging	Het
Rasd2	T	A	8: 75,221,936	D163E	possibly damaging	Het
Rgs11	A	G	17: 26,207,973		probably benign	Het
Scap	T	C	9: 110,353,152	I37T	possibly damaging	Het
Sgms2	C	T	3: 131,330,356	V232M	probably benign	Het
Slc25a54	A	G	3: 109,102,700	I172V	probably benign	Het
Sympk	C	T	7: 19,036,042	R215C	probably benign	Het
Tacc2	T	A	7: 130,735,014	D171E	probably damaging	Het
Tmco4	A	G	4: 139,058,506	E629G	probably benign	Het
Trav7-1	T	G	14: 52,655,308	L106R	possibly damaging	Het
Ugt1a1	CAGAGAGAGAGAGA	CAGAGAGAGAGA	1: 88,211,984		probably benign	Het
Utf1	T	C	7: 139,944,901		probably benign	Het
Zdhhc13	A	G	7: 48,824,731	N577S	possibly damaging	Het
Zmym6	A	G	4: 127,123,974	N1183D	possibly damaging	Het

Other mutations in Cd180

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00778:Cd180	APN	13	102705409	missense	probably benign
IGL00949:Cd180	APN	13	102693760	missense	possibly damaging	0.89
IGL01864:Cd180	APN	13	102706033	missense	possibly damaging	0.93
IGL01901:Cd180	APN	13	102706428	missense	probably benign	0.04
IGL01934:Cd180	APN	13	102702858	missense	probably damaging	1.00
IGL01998:Cd180	APN	13	102705214	missense	probably damaging	0.99
IGL02336:Cd180	APN	13	102705313	missense	probably damaging	0.98
IGL03031:Cd180	APN	13	102705027	missense	probably benign	0.00
IGL03139:Cd180	APN	13	102706416	missense	probably damaging	1.00
Volte_face	UTSW	13	102704923	missense	probably damaging	0.99
H8562:Cd180	UTSW	13	102705418	missense	probably benign	0.02
R0004:Cd180	UTSW	13	102702708	missense	probably benign	0.00
R0393:Cd180	UTSW	13	102705900	missense	probably damaging	0.99
R0565:Cd180	UTSW	13	102702874	intron	probably benign
R1080:Cd180	UTSW	13	102706220	nonsense	probably null
R1223:Cd180	UTSW	13	102706222	missense	possibly damaging	0.49
R1669:Cd180	UTSW	13	102705490	missense	probably damaging	1.00
R1772:Cd180	UTSW	13	102706242	missense	probably benign	0.11
R1784:Cd180	UTSW	13	102705859	missense	probably damaging	1.00
R1865:Cd180	UTSW	13	102706009	missense	probably benign
R2252:Cd180	UTSW	13	102706398	nonsense	probably null
R2385:Cd180	UTSW	13	102705183	missense	probably benign	0.00
R4653:Cd180	UTSW	13	102704908	missense	probably damaging	1.00
R4695:Cd180	UTSW	13	102705760	missense	probably benign	0.01
R4790:Cd180	UTSW	13	102702822	missense	probably damaging	0.98
R4934:Cd180	UTSW	13	102739164	critical splice acceptor site	probably null
R5154:Cd180	UTSW	13	102705774	missense	probably damaging	1.00
R5469:Cd180	UTSW	13	102704834	missense	probably benign	0.37
R5493:Cd180	UTSW	13	102706141	missense	probably benign	0.07
R5615:Cd180	UTSW	13	102706203	missense	probably benign	0.34
R5905:Cd180	UTSW	13	102706033	missense	possibly damaging	0.93
R6282:Cd180	UTSW	13	102693757	missense	possibly damaging	0.90
R6433:Cd180	UTSW	13	102705633	missense	probably benign	0.00
R6456:Cd180	UTSW	13	102702836	missense	probably damaging	1.00
R6784:Cd180	UTSW	13	102702705	missense	probably damaging	0.97
R6815:Cd180	UTSW	13	102705429	missense	probably damaging	1.00
R6838:Cd180	UTSW	13	102702731	missense	probably benign	0.38
R6941:Cd180	UTSW	13	102706191	missense	probably benign	0.23
R7048:Cd180	UTSW	13	102704923	missense	probably damaging	0.99
R7338:Cd180	UTSW	13	102706428	missense	probably benign	0.04
R7466:Cd180	UTSW	13	102704995	missense	probably damaging	1.00
R7647:Cd180	UTSW	13	102705943	missense	probably damaging	1.00
R8179:Cd180	UTSW	13	102705633	missense	probably benign	0.00
R8252:Cd180	UTSW	13	102705996	missense	probably benign	0.00
R8300:Cd180	UTSW	13	102704793	missense	probably benign	0.01
R8460:Cd180	UTSW	13	102702846	missense	probably damaging	1.00
Z1176:Cd180	UTSW	13	102705766	missense	probably damaging	1.00
Z1177:Cd180	UTSW	13	102706032	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- CTTCTTTGAGGTGCCAGATTTAC -3'
(R):5'- TTTGGAAGACAGCTGAGTCG -3'

Sequencing Primer
(F):5'- TGGCAGAGACAGCACTTA -3'
(R):5'- GACAGCTGAGTCGAAAGCCC -3'

Posted On

2016-06-15