Incidental Mutation 'R5052:Elp3'
ID394710
Institutional Source Beutler Lab
Gene Symbol Elp3
Ensembl Gene ENSMUSG00000022031
Gene Nameelongator acetyltransferase complex subunit 3
SynonymsKAT9, 2610507P14Rik
MMRRC Submission 042642-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.954) question?
Stock #R5052 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location65530449-65593075 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 65577940 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 220 (I220N)
Ref Sequence ENSEMBL: ENSMUSP00000022609 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022609] [ENSMUST00000224743] [ENSMUST00000225355]
Predicted Effect probably damaging
Transcript: ENSMUST00000022609
AA Change: I220N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022609
Gene: ENSMUSG00000022031
AA Change: I220N

DomainStartEndE-ValueType
Elp3 108 370 1.36e-37 SMART
Blast:Elp3 387 431 2e-19 BLAST
Pfam:Acetyltransf_1 460 555 1.1e-6 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000224743
AA Change: I201N

PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect probably damaging
Transcript: ENSMUST00000225355
AA Change: I201N

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
Meta Mutation Damage Score 0.4423 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.0%
  • 10x: 94.8%
  • 20x: 86.2%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ELP3 is the catalytic subunit of the histone acetyltransferase elongator complex, which contributes to transcript elongation and also regulates the maturation of projection neurons (Creppe et al., 2009 [PubMed 19185337]).[supplied by OMIM, Apr 2009]
PHENOTYPE: Embryos homozygous for a null gene trap mutation show severe growth retardation and die prior to E12.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd3 A T 3: 121,769,513 probably null Het
Adgrv1 T C 13: 81,528,821 T1964A probably damaging Het
Agbl5 C T 5: 30,891,214 T210I possibly damaging Het
Ak5 T C 3: 152,660,567 T66A probably benign Het
Aktip G A 8: 91,129,651 T66I possibly damaging Het
Aldh1l2 T C 10: 83,508,692 Y330C possibly damaging Het
Btbd19 T G 4: 117,122,257 K122Q possibly damaging Het
Cd180 A G 13: 102,704,895 T150A probably benign Het
Celsr2 A G 3: 108,412,358 I1046T probably damaging Het
Cep170 C T 1: 176,793,551 R20Q probably damaging Het
Cercam T A 2: 29,875,627 N260K probably damaging Het
Cfh T A 1: 140,144,044 H284L probably damaging Het
Chmp5 A G 4: 40,948,608 M1V probably null Het
Esyt2 A G 12: 116,367,796 T765A probably damaging Het
Evi5l T C 8: 4,206,019 probably benign Het
Gm5866 T G 5: 52,582,892 noncoding transcript Het
Grik1 C A 16: 87,950,098 G417V probably benign Het
Gtpbp1 T G 15: 79,715,969 I399R probably damaging Het
Il17rc T C 6: 113,472,323 C14R probably damaging Het
Ipo9 T C 1: 135,388,611 probably null Het
Kazn G A 4: 142,118,203 probably benign Het
Map3k15 T C X: 159,988,746 V105A possibly damaging Het
Mitf A G 6: 98,010,445 T320A possibly damaging Het
Ncapd3 T G 9: 27,051,719 L440R probably damaging Het
Nrxn2 C G 19: 6,455,204 A359G probably damaging Het
P2rx3 T G 2: 84,999,024 I371L probably benign Het
Pde1b C A 15: 103,527,648 Q493K possibly damaging Het
Ptpn13 T C 5: 103,561,980 F1503S probably damaging Het
Ptprz1 T G 6: 23,045,626 W1283G probably damaging Het
Rasd2 T A 8: 75,221,936 D163E possibly damaging Het
Rgs11 A G 17: 26,207,973 probably benign Het
Scap T C 9: 110,353,152 I37T possibly damaging Het
Sgms2 C T 3: 131,330,356 V232M probably benign Het
Slc25a54 A G 3: 109,102,700 I172V probably benign Het
Sympk C T 7: 19,036,042 R215C probably benign Het
Tacc2 T A 7: 130,735,014 D171E probably damaging Het
Tmco4 A G 4: 139,058,506 E629G probably benign Het
Trav7-1 T G 14: 52,655,308 L106R possibly damaging Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Utf1 T C 7: 139,944,901 probably benign Het
Zdhhc13 A G 7: 48,824,731 N577S possibly damaging Het
Zmym6 A G 4: 127,123,974 N1183D possibly damaging Het
Other mutations in Elp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02477:Elp3 APN 14 65563311 missense probably benign
R0052:Elp3 UTSW 14 65531526 makesense probably null
R0333:Elp3 UTSW 14 65590593 missense probably benign 0.05
R0513:Elp3 UTSW 14 65563246 splice site probably null
R0980:Elp3 UTSW 14 65577953 missense probably damaging 1.00
R1137:Elp3 UTSW 14 65547921 missense probably damaging 0.99
R1259:Elp3 UTSW 14 65547939 missense probably damaging 0.96
R1378:Elp3 UTSW 14 65592931 missense probably benign
R1722:Elp3 UTSW 14 65551397 missense probably benign 0.02
R1789:Elp3 UTSW 14 65547919 missense probably damaging 1.00
R3843:Elp3 UTSW 14 65565483 splice site probably null
R4125:Elp3 UTSW 14 65560181 missense possibly damaging 0.64
R4196:Elp3 UTSW 14 65548002 missense probably damaging 1.00
R4400:Elp3 UTSW 14 65548090 missense possibly damaging 0.89
R4420:Elp3 UTSW 14 65580791 missense probably damaging 1.00
R4516:Elp3 UTSW 14 65547877 missense possibly damaging 0.46
R4764:Elp3 UTSW 14 65582929 missense probably damaging 1.00
R4838:Elp3 UTSW 14 65547864 critical splice donor site probably null
R5111:Elp3 UTSW 14 65560236 missense probably damaging 1.00
R5665:Elp3 UTSW 14 65551402 missense possibly damaging 0.80
R5702:Elp3 UTSW 14 65577982 missense probably damaging 1.00
R5754:Elp3 UTSW 14 65547990 missense probably damaging 1.00
R5927:Elp3 UTSW 14 65582177 missense probably damaging 1.00
R5999:Elp3 UTSW 14 65531540 missense probably benign 0.01
R6378:Elp3 UTSW 14 65592971 nonsense probably null
R6384:Elp3 UTSW 14 65560211 missense probably damaging 1.00
R6601:Elp3 UTSW 14 65547039 makesense probably null
R7263:Elp3 UTSW 14 65565333 missense probably damaging 0.98
R7857:Elp3 UTSW 14 65563310 missense probably benign 0.14
R8504:Elp3 UTSW 14 65547911 missense probably benign 0.03
R8789:Elp3 UTSW 14 65565421 missense probably damaging 1.00
R8853:Elp3 UTSW 14 65577941 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- GCCTGTGTCTGAAAAGATCTATG -3'
(R):5'- GCAACTCTCTGATGGATGTGTG -3'

Sequencing Primer
(F):5'- TGACTATGCCAATGAAACATACTTG -3'
(R):5'- GTGTGCTTCTTCCAGCTAAAGCAG -3'
Posted On2016-06-15