Incidental Mutation 'R5052:Grik1'
ID394713
Institutional Source Beutler Lab
Gene Symbol Grik1
Ensembl Gene ENSMUSG00000022935
Gene Nameglutamate receptor, ionotropic, kainate 1
SynonymsGlurbeta1, Glur5, D16Ium24e, Glur-5, D16Ium24, GluK5, A830007B11Rik
MMRRC Submission 042642-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5052 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location87895900-88290265 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 87950098 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 417 (G417V)
Ref Sequence ENSEMBL: ENSMUSP00000072107 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023652] [ENSMUST00000072256] [ENSMUST00000114137] [ENSMUST00000211444] [ENSMUST00000227986] [ENSMUST00000228034] [ENSMUST00000228188]
Predicted Effect probably benign
Transcript: ENSMUST00000023652
AA Change: G417V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000023652
Gene: ENSMUSG00000022935
AA Change: G417V

DomainStartEndE-ValueType
Pfam:ANF_receptor 14 357 4.7e-69 PFAM
Pfam:Peripla_BP_6 48 347 5.1e-11 PFAM
PBPe 394 762 2.4e-130 SMART
Lig_chan-Glu_bd 404 468 6.34e-31 SMART
Blast:PBPe 770 815 2e-16 BLAST
low complexity region 829 850 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000072256
AA Change: G417V

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000072107
Gene: ENSMUSG00000022935
AA Change: G417V

DomainStartEndE-ValueType
Pfam:ANF_receptor 14 357 2.6e-72 PFAM
Pfam:Peripla_BP_6 49 347 3.4e-10 PFAM
PBPe 394 762 2.4e-130 SMART
Lig_chan-Glu_bd 404 468 6.34e-31 SMART
Blast:PBPe 770 817 1e-17 BLAST
low complexity region 858 879 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114137
AA Change: G346V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000109773
Gene: ENSMUSG00000022935
AA Change: G346V

DomainStartEndE-ValueType
Pfam:ANF_receptor 1 325 5.4e-63 PFAM
Pfam:Peripla_BP_6 18 315 5.1e-11 PFAM
PBPe 362 730 2.4e-130 SMART
Lig_chan-Glu_bd 372 436 6.34e-31 SMART
Blast:PBPe 738 783 2e-16 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210910
Predicted Effect probably benign
Transcript: ENSMUST00000211444
AA Change: G417V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211635
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226447
Predicted Effect probably benign
Transcript: ENSMUST00000227986
AA Change: G432V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000228034
AA Change: G432V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000228188
AA Change: G432V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.0%
  • 10x: 94.8%
  • 20x: 86.2%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. This gene product belongs to the kainate family of glutamate receptors, which are composed of four subunits and function as ligand-activated ion channels. The subunit encoded by this gene is subject to RNA editing (CAG->CGG; Q->R) within the second transmembrane domain, which is thought to alter the properties of ion flow. Alternative splicing, resulting in transcript variants encoding different isoforms, has been noted for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display subtile abnormalities in the electrophysiology of neurons in the brain. Response to chemical pain stimuli is also reduced. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd3 A T 3: 121,769,513 probably null Het
Adgrv1 T C 13: 81,528,821 T1964A probably damaging Het
Agbl5 C T 5: 30,891,214 T210I possibly damaging Het
Ak5 T C 3: 152,660,567 T66A probably benign Het
Aktip G A 8: 91,129,651 T66I possibly damaging Het
Aldh1l2 T C 10: 83,508,692 Y330C possibly damaging Het
Btbd19 T G 4: 117,122,257 K122Q possibly damaging Het
Cd180 A G 13: 102,704,895 T150A probably benign Het
Celsr2 A G 3: 108,412,358 I1046T probably damaging Het
Cep170 C T 1: 176,793,551 R20Q probably damaging Het
Cercam T A 2: 29,875,627 N260K probably damaging Het
Cfh T A 1: 140,144,044 H284L probably damaging Het
Chmp5 A G 4: 40,948,608 M1V probably null Het
Elp3 A T 14: 65,577,940 I220N probably damaging Het
Esyt2 A G 12: 116,367,796 T765A probably damaging Het
Evi5l T C 8: 4,206,019 probably benign Het
Gm5866 T G 5: 52,582,892 noncoding transcript Het
Gtpbp1 T G 15: 79,715,969 I399R probably damaging Het
Il17rc T C 6: 113,472,323 C14R probably damaging Het
Ipo9 T C 1: 135,388,611 probably null Het
Kazn G A 4: 142,118,203 probably benign Het
Map3k15 T C X: 159,988,746 V105A possibly damaging Het
Mitf A G 6: 98,010,445 T320A possibly damaging Het
Ncapd3 T G 9: 27,051,719 L440R probably damaging Het
Nrxn2 C G 19: 6,455,204 A359G probably damaging Het
P2rx3 T G 2: 84,999,024 I371L probably benign Het
Pde1b C A 15: 103,527,648 Q493K possibly damaging Het
Ptpn13 T C 5: 103,561,980 F1503S probably damaging Het
Ptprz1 T G 6: 23,045,626 W1283G probably damaging Het
Rasd2 T A 8: 75,221,936 D163E possibly damaging Het
Rgs11 A G 17: 26,207,973 probably benign Het
Scap T C 9: 110,353,152 I37T possibly damaging Het
Sgms2 C T 3: 131,330,356 V232M probably benign Het
Slc25a54 A G 3: 109,102,700 I172V probably benign Het
Sympk C T 7: 19,036,042 R215C probably benign Het
Tacc2 T A 7: 130,735,014 D171E probably damaging Het
Tmco4 A G 4: 139,058,506 E629G probably benign Het
Trav7-1 T G 14: 52,655,308 L106R possibly damaging Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Utf1 T C 7: 139,944,901 probably benign Het
Zdhhc13 A G 7: 48,824,731 N577S possibly damaging Het
Zmym6 A G 4: 127,123,974 N1183D possibly damaging Het
Other mutations in Grik1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01143:Grik1 APN 16 87957600 splice site probably null
IGL01347:Grik1 APN 16 87957593 missense probably benign 0.00
IGL01612:Grik1 APN 16 87946735 missense probably damaging 1.00
IGL02010:Grik1 APN 16 88051508 missense possibly damaging 0.96
IGL02059:Grik1 APN 16 88056049 missense possibly damaging 0.95
IGL02068:Grik1 APN 16 87940651 missense possibly damaging 0.80
IGL02200:Grik1 APN 16 87940565 missense probably damaging 1.00
IGL02206:Grik1 APN 16 87935920 missense probably damaging 1.00
IGL02375:Grik1 APN 16 87946556 missense probably damaging 1.00
IGL02598:Grik1 APN 16 87947984 missense probably damaging 1.00
IGL02686:Grik1 APN 16 88009761 splice site probably null
IGL02890:Grik1 APN 16 87896802 intron probably benign
R0096:Grik1 UTSW 16 88034226 missense possibly damaging 0.55
R0096:Grik1 UTSW 16 88034226 missense possibly damaging 0.55
R0387:Grik1 UTSW 16 88034350 splice site probably benign
R0613:Grik1 UTSW 16 88051333 critical splice donor site probably null
R1087:Grik1 UTSW 16 88006377 missense probably benign 0.00
R1694:Grik1 UTSW 16 87950068 missense probably damaging 0.96
R1905:Grik1 UTSW 16 87896866 nonsense probably null
R1928:Grik1 UTSW 16 88051353 missense probably damaging 0.99
R2157:Grik1 UTSW 16 88056124 missense probably damaging 1.00
R3122:Grik1 UTSW 16 88006473 missense probably damaging 1.00
R3906:Grik1 UTSW 16 88006449 missense probably benign 0.00
R4194:Grik1 UTSW 16 87946728 missense probably benign 0.45
R4343:Grik1 UTSW 16 87896252 missense probably benign 0.00
R4349:Grik1 UTSW 16 87957543 missense probably damaging 1.00
R4416:Grik1 UTSW 16 88051461 missense probably benign 0.00
R4423:Grik1 UTSW 16 87923200 missense probably benign 0.10
R4660:Grik1 UTSW 16 87923131 missense probably damaging 1.00
R4804:Grik1 UTSW 16 87957569 missense probably damaging 0.99
R5126:Grik1 UTSW 16 87947859 missense probably damaging 1.00
R5334:Grik1 UTSW 16 87923194 frame shift probably null
R5335:Grik1 UTSW 16 87923194 frame shift probably null
R5337:Grik1 UTSW 16 87923194 frame shift probably null
R5479:Grik1 UTSW 16 87936026 missense probably damaging 1.00
R6141:Grik1 UTSW 16 87896872 missense probably benign 0.00
R6188:Grik1 UTSW 16 88056071 missense probably benign 0.06
R6335:Grik1 UTSW 16 87947906 missense probably damaging 1.00
R6610:Grik1 UTSW 16 88034312 missense probably damaging 1.00
R6737:Grik1 UTSW 16 88051391 missense probably damaging 1.00
R7275:Grik1 UTSW 16 87912820 missense probably benign 0.06
R7876:Grik1 UTSW 16 87923233 missense
R8021:Grik1 UTSW 16 87914222 missense
R8027:Grik1 UTSW 16 87936005 missense
R8096:Grik1 UTSW 16 88006467 missense
R8266:Grik1 UTSW 16 87947979 missense probably benign
RF016:Grik1 UTSW 16 88034186 missense
RF022:Grik1 UTSW 16 87896337 missense
X0018:Grik1 UTSW 16 87946596 missense probably damaging 1.00
Z1177:Grik1 UTSW 16 87946684 missense
Predicted Primers PCR Primer
(F):5'- CATGCAGAAAGCCTTGCCAG -3'
(R):5'- CTCAGATTTAAGCTTCTACACGTG -3'

Sequencing Primer
(F):5'- CCTTGCCAGGCTGGAAAAGAC -3'
(R):5'- TACCAAGTAGTCTCCACTGTGAGG -3'
Posted On2016-06-15