Incidental Mutation 'R5053:Olfr1211'
ID394724
Institutional Source Beutler Lab
Gene Symbol Olfr1211
Ensembl Gene ENSMUSG00000075112
Gene Nameolfactory receptor 1211
SynonymsMOR233-21, MOR233-16P, GA_x6K02T2Q125-50409367-50408432
MMRRC Submission 042643-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R5053 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location88926876-88938111 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 88930253 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 21 (V21F)
Ref Sequence ENSEMBL: ENSMUSP00000150571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099808] [ENSMUST00000213412] [ENSMUST00000215205]
Predicted Effect probably benign
Transcript: ENSMUST00000099808
AA Change: V21F

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000097396
Gene: ENSMUSG00000075112
AA Change: V21F

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 9.5e-49 PFAM
Pfam:7tm_1 39 286 2.5e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141958
Predicted Effect probably benign
Transcript: ENSMUST00000213412
AA Change: V21F

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect probably benign
Transcript: ENSMUST00000215205
AA Change: V21F

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.3%
  • 10x: 95.9%
  • 20x: 90.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvrl1 A T 15: 101,137,369 I259F probably damaging Het
Adgrf2 A G 17: 42,710,443 S497P probably damaging Het
Adsl T C 15: 80,960,450 C180R probably damaging Het
Ahctf1 A G 1: 179,786,784 I448T possibly damaging Het
Alg9 G T 9: 50,788,172 G200W probably damaging Het
Amhr2 G A 15: 102,447,258 V213I probably damaging Het
Ankrd44 A T 1: 54,735,089 L200* probably null Het
As3mt A G 19: 46,709,054 Y87C probably damaging Het
Bcl11a C A 11: 24,164,068 F470L probably benign Het
Cacna2d2 A T 9: 107,514,864 Y468F probably damaging Het
Cep250 A G 2: 155,962,928 D71G possibly damaging Het
Clca4b T C 3: 144,911,121 T923A probably benign Het
Clec16a T C 16: 10,576,597 L273P probably damaging Het
Comtd1 T C 14: 21,847,696 D123G probably damaging Het
Cpa5 A T 6: 30,623,272 E144V probably damaging Het
Cyp2c37 G A 19: 40,001,887 S343N probably benign Het
Dennd6a C A 14: 26,608,583 T103K probably damaging Het
Ect2l A G 10: 18,140,345 L733P probably damaging Het
Erg T A 16: 95,524,534 H11L probably benign Het
Ero1lb T C 13: 12,599,906 L253P probably damaging Het
Etfbkmt T A 6: 149,147,268 L135* probably null Het
Frmd4a A T 2: 4,603,921 T867S probably damaging Het
Gm815 C T 19: 26,886,413 A18V unknown Het
Gna12 C A 5: 140,760,727 R321L probably benign Het
Herc1 A T 9: 66,470,326 K3458M possibly damaging Het
Irs1 A G 1: 82,286,922 L1191P probably benign Het
Kcp G T 6: 29,496,958 Q551K probably benign Het
Klhl11 C T 11: 100,472,200 V177M probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Llcfc1 A G 6: 41,685,335 H91R possibly damaging Het
Lmnb2 A T 10: 80,904,655 M223K probably damaging Het
Mbd6 C T 10: 127,286,441 V173I probably benign Het
Mme T A 3: 63,364,849 V623E probably damaging Het
Ndc1 T C 4: 107,374,218 S119P probably damaging Het
Nfs1 A C 2: 156,126,398 C383G probably damaging Het
Nphp4 A G 4: 152,544,462 probably null Het
Oca2 C A 7: 56,323,580 Q411K probably benign Het
Olfr1061 A G 2: 86,413,338 F238S probably damaging Het
Olfr1377 G A 11: 50,985,310 G203D probably damaging Het
Olfr479 A G 7: 108,055,534 H184R probably benign Het
Olfr748 T A 14: 50,710,511 Y60* probably null Het
Pcdh7 A T 5: 57,721,601 T493S probably damaging Het
Phf20 T C 2: 156,273,862 S368P probably benign Het
Pla2g2e T G 4: 138,880,375 V22G possibly damaging Het
Plxna1 A T 6: 89,322,460 H1736Q probably damaging Het
Prlr C A 15: 10,325,385 Q215K probably benign Het
Prpf6 T C 2: 181,649,453 V687A probably benign Het
Ptprq T A 10: 107,563,202 T1951S probably damaging Het
Sec31a G T 5: 100,393,214 Q345K possibly damaging Het
Serpina3k T C 12: 104,343,214 probably null Het
Sertad3 T A 7: 27,476,522 V127E probably benign Het
Sf3b1 A T 1: 54,997,177 N912K probably benign Het
Shq1 A G 6: 100,655,259 L202P probably damaging Het
Sp8 C T 12: 118,849,604 T398M probably damaging Het
Tmem150c A T 5: 100,083,740 D125E probably benign Het
Trim3 G T 7: 105,617,761 D470E probably damaging Het
Ubap1 T A 4: 41,387,315 C88* probably null Het
Unc79 T A 12: 103,104,748 D1124E probably damaging Het
Usf3 T C 16: 44,217,187 S677P probably benign Het
Vmn1r76 T C 7: 11,930,314 probably null Het
Zfp819 C T 7: 43,617,146 T275I probably damaging Het
Zranb2 T A 3: 157,541,159 D161E probably damaging Het
Other mutations in Olfr1211
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02724:Olfr1211 APN 2 88929448 missense probably damaging 1.00
IGL02936:Olfr1211 APN 2 88929784 missense probably benign 0.01
IGL02960:Olfr1211 APN 2 88929784 missense possibly damaging 0.80
IGL02989:Olfr1211 APN 2 88929704 missense possibly damaging 0.72
R0193:Olfr1211 UTSW 2 88930283 missense probably benign 0.01
R0413:Olfr1211 UTSW 2 88929562 missense probably benign 0.16
R1644:Olfr1211 UTSW 2 88929387 missense probably benign 0.01
R3715:Olfr1211 UTSW 2 88929413 missense probably benign 0.07
R4019:Olfr1211 UTSW 2 88929736 missense probably benign 0.02
R4722:Olfr1211 UTSW 2 88929980 missense possibly damaging 0.91
R4751:Olfr1211 UTSW 2 88929914 missense probably damaging 1.00
R4859:Olfr1211 UTSW 2 88930283 missense probably benign 0.01
R6148:Olfr1211 UTSW 2 88930253 missense probably benign 0.00
R7064:Olfr1211 UTSW 2 88929509 missense probably benign 0.00
R7527:Olfr1211 UTSW 2 88930090 missense probably benign 0.00
R7584:Olfr1211 UTSW 2 88929805 missense probably damaging 1.00
R7989:Olfr1211 UTSW 2 88929514 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCATCTTTGGTGTGATGACAGAAG -3'
(R):5'- TATGTACATGTGTTGGGCAAAGC -3'

Sequencing Primer
(F):5'- TGACAGAAGAGAAGCATGCATCC -3'
(R):5'- TTGGGCAAAGCACTGTTTTC -3'
Posted On2016-06-15