Incidental Mutation 'R5053:Sec31a'
ID394739
Institutional Source Beutler Lab
Gene Symbol Sec31a
Ensembl Gene ENSMUSG00000035325
Gene NameSec31 homolog A (S. cerevisiae)
SynonymsSec31l1, 1810024J13Rik
MMRRC Submission 042643-MU
Accession Numbers

Genbank: NM_026969; MGI: 1916412; Ensembl: ENSMUST00000046296, ENSMUST00000094578, ENSMUST00000112918

Is this an essential gene? Probably essential (E-score: 0.874) question?
Stock #R5053 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location100361649-100416234 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 100393214 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 345 (Q345K)
Ref Sequence ENSEMBL: ENSMUSP00000138213 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094578] [ENSMUST00000182886] [ENSMUST00000183247]
Predicted Effect possibly damaging
Transcript: ENSMUST00000094578
AA Change: Q345K

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000092157
Gene: ENSMUSG00000035325
AA Change: Q345K

DomainStartEndE-ValueType
WD40 56 102 1.59e1 SMART
WD40 111 151 5.15e-2 SMART
WD40 158 197 5.16e-1 SMART
WD40 200 245 6.63e0 SMART
WD40 249 289 1.95e-2 SMART
WD40 292 332 4.24e-3 SMART
low complexity region 363 373 N/A INTRINSIC
Pfam:Sec16_C 572 769 3.5e-7 PFAM
low complexity region 866 882 N/A INTRINSIC
low complexity region 930 949 N/A INTRINSIC
low complexity region 953 975 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000182886
AA Change: Q345K

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000138213
Gene: ENSMUSG00000035325
AA Change: Q345K

DomainStartEndE-ValueType
WD40 56 102 1e-1 SMART
WD40 111 151 3.3e-4 SMART
WD40 158 197 3.2e-3 SMART
WD40 200 245 4.1e-2 SMART
WD40 249 289 1.2e-4 SMART
WD40 292 332 2.6e-5 SMART
low complexity region 363 373 N/A INTRINSIC
Pfam:Sec16_C 532 731 2.1e-6 PFAM
low complexity region 827 843 N/A INTRINSIC
low complexity region 891 910 N/A INTRINSIC
low complexity region 914 936 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000182988
AA Change: Q84K

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000183247
SMART Domains Protein: ENSMUSP00000138129
Gene: ENSMUSG00000035325

DomainStartEndE-ValueType
Pfam:Sec16_C 141 248 1.5e-7 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.3%
  • 10x: 95.9%
  • 20x: 90.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shares similarity with the yeast Sec31 protein, and is a component of the outer layer of the coat protein complex II (COPII). The encoded protein is involved in vesicle budding from the endoplasmic reticulum (ER) and contains multiple WD repeats near the N-terminus and a proline-rich region in the C-terminal half. It associates with the protein encoded by the SEC13 homolog, nuclear pore and COPII coat complex component (SEC13), and is required for ER-Golgi transport. Monoubiquitylation of this protein by CUL3-KLHL12 was found to regulate the size of COPII coats to accommodate unusually shaped cargo. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
Allele List at MGI

All alleles(31) : Gene trapped(31)

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvrl1 A T 15: 101,137,369 I259F probably damaging Het
Adgrf2 A G 17: 42,710,443 S497P probably damaging Het
Adsl T C 15: 80,960,450 C180R probably damaging Het
Ahctf1 A G 1: 179,786,784 I448T possibly damaging Het
Alg9 G T 9: 50,788,172 G200W probably damaging Het
Amhr2 G A 15: 102,447,258 V213I probably damaging Het
Ankrd44 A T 1: 54,735,089 L200* probably null Het
As3mt A G 19: 46,709,054 Y87C probably damaging Het
Bcl11a C A 11: 24,164,068 F470L probably benign Het
Cacna2d2 A T 9: 107,514,864 Y468F probably damaging Het
Cep250 A G 2: 155,962,928 D71G possibly damaging Het
Clca4b T C 3: 144,911,121 T923A probably benign Het
Clec16a T C 16: 10,576,597 L273P probably damaging Het
Comtd1 T C 14: 21,847,696 D123G probably damaging Het
Cpa5 A T 6: 30,623,272 E144V probably damaging Het
Cyp2c37 G A 19: 40,001,887 S343N probably benign Het
Dennd6a C A 14: 26,608,583 T103K probably damaging Het
Ect2l A G 10: 18,140,345 L733P probably damaging Het
Erg T A 16: 95,524,534 H11L probably benign Het
Ero1lb T C 13: 12,599,906 L253P probably damaging Het
Etfbkmt T A 6: 149,147,268 L135* probably null Het
Frmd4a A T 2: 4,603,921 T867S probably damaging Het
Gm815 C T 19: 26,886,413 A18V unknown Het
Gna12 C A 5: 140,760,727 R321L probably benign Het
Herc1 A T 9: 66,470,326 K3458M possibly damaging Het
Irs1 A G 1: 82,286,922 L1191P probably benign Het
Kcp G T 6: 29,496,958 Q551K probably benign Het
Klhl11 C T 11: 100,472,200 V177M probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Llcfc1 A G 6: 41,685,335 H91R possibly damaging Het
Lmnb2 A T 10: 80,904,655 M223K probably damaging Het
Mbd6 C T 10: 127,286,441 V173I probably benign Het
Mme T A 3: 63,364,849 V623E probably damaging Het
Ndc1 T C 4: 107,374,218 S119P probably damaging Het
Nfs1 A C 2: 156,126,398 C383G probably damaging Het
Nphp4 A G 4: 152,544,462 probably null Het
Oca2 C A 7: 56,323,580 Q411K probably benign Het
Olfr1061 A G 2: 86,413,338 F238S probably damaging Het
Olfr1211 C A 2: 88,930,253 V21F probably benign Het
Olfr1377 G A 11: 50,985,310 G203D probably damaging Het
Olfr479 A G 7: 108,055,534 H184R probably benign Het
Olfr748 T A 14: 50,710,511 Y60* probably null Het
Pcdh7 A T 5: 57,721,601 T493S probably damaging Het
Phf20 T C 2: 156,273,862 S368P probably benign Het
Pla2g2e T G 4: 138,880,375 V22G possibly damaging Het
Plxna1 A T 6: 89,322,460 H1736Q probably damaging Het
Prlr C A 15: 10,325,385 Q215K probably benign Het
Prpf6 T C 2: 181,649,453 V687A probably benign Het
Ptprq T A 10: 107,563,202 T1951S probably damaging Het
Serpina3k T C 12: 104,343,214 probably null Het
Sertad3 T A 7: 27,476,522 V127E probably benign Het
Sf3b1 A T 1: 54,997,177 N912K probably benign Het
Shq1 A G 6: 100,655,259 L202P probably damaging Het
Sp8 C T 12: 118,849,604 T398M probably damaging Het
Tmem150c A T 5: 100,083,740 D125E probably benign Het
Trim3 G T 7: 105,617,761 D470E probably damaging Het
Ubap1 T A 4: 41,387,315 C88* probably null Het
Unc79 T A 12: 103,104,748 D1124E probably damaging Het
Usf3 T C 16: 44,217,187 S677P probably benign Het
Vmn1r76 T C 7: 11,930,314 probably null Het
Zfp819 C T 7: 43,617,146 T275I probably damaging Het
Zranb2 T A 3: 157,541,159 D161E probably damaging Het
Other mutations in Sec31a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00657:Sec31a APN 5 100404017 nonsense probably null
IGL01610:Sec31a APN 5 100402358 splice site probably benign
IGL01804:Sec31a APN 5 100375206 critical splice donor site probably null
IGL02026:Sec31a APN 5 100369626 missense probably benign 0.04
IGL02150:Sec31a APN 5 100386125 splice site probably benign
IGL02237:Sec31a APN 5 100362055 missense probably damaging 1.00
IGL02469:Sec31a APN 5 100385255 missense probably benign 0.02
IGL02512:Sec31a APN 5 100407193 missense probably damaging 0.99
control UTSW 5 100362173 missense probably damaging 1.00
D3080:Sec31a UTSW 5 100363832 missense probably damaging 1.00
PIT4142001:Sec31a UTSW 5 100407275 missense probably damaging 1.00
R0366:Sec31a UTSW 5 100382766 missense probably damaging 1.00
R0453:Sec31a UTSW 5 100404118 splice site probably benign
R0511:Sec31a UTSW 5 100375240 missense probably benign 0.01
R0546:Sec31a UTSW 5 100404070 missense probably damaging 1.00
R0675:Sec31a UTSW 5 100393207 missense probably damaging 0.97
R0678:Sec31a UTSW 5 100407225 missense possibly damaging 0.74
R0975:Sec31a UTSW 5 100395904 splice site probably null
R1146:Sec31a UTSW 5 100362173 missense probably damaging 1.00
R1146:Sec31a UTSW 5 100362173 missense probably damaging 1.00
R1540:Sec31a UTSW 5 100375319 missense probably damaging 1.00
R1616:Sec31a UTSW 5 100386195 missense possibly damaging 0.88
R1780:Sec31a UTSW 5 100381336 splice site probably null
R2472:Sec31a UTSW 5 100385205 missense probably damaging 1.00
R3689:Sec31a UTSW 5 100382907 missense probably damaging 1.00
R4515:Sec31a UTSW 5 100365958 missense probably damaging 0.99
R4801:Sec31a UTSW 5 100393363 missense probably damaging 0.96
R4802:Sec31a UTSW 5 100393363 missense probably damaging 0.96
R4896:Sec31a UTSW 5 100368333 missense probably damaging 1.00
R5004:Sec31a UTSW 5 100368333 missense probably damaging 1.00
R5158:Sec31a UTSW 5 100393321 missense probably damaging 0.99
R5191:Sec31a UTSW 5 100405511 missense possibly damaging 0.75
R5222:Sec31a UTSW 5 100382895 missense probably benign
R5405:Sec31a UTSW 5 100383798 nonsense probably null
R5436:Sec31a UTSW 5 100363839 missense probably damaging 0.98
R5577:Sec31a UTSW 5 100402274 missense possibly damaging 0.95
R6005:Sec31a UTSW 5 100363878 missense probably damaging 1.00
R6184:Sec31a UTSW 5 100369594 critical splice donor site probably null
R6245:Sec31a UTSW 5 100386184 missense probably benign 0.07
R6475:Sec31a UTSW 5 100385270 missense probably damaging 1.00
R6476:Sec31a UTSW 5 100386149 missense probably benign 0.03
R6744:Sec31a UTSW 5 100392499 missense possibly damaging 0.47
R6804:Sec31a UTSW 5 100382812 missense probably benign 0.03
R6911:Sec31a UTSW 5 100393264 missense possibly damaging 0.92
R6936:Sec31a UTSW 5 100392510 missense probably benign
R7345:Sec31a UTSW 5 100385270 missense probably damaging 1.00
R7760:Sec31a UTSW 5 100392628 missense probably damaging 1.00
R7898:Sec31a UTSW 5 100399477 missense probably damaging 0.99
R8088:Sec31a UTSW 5 100378862 missense
R8555:Sec31a UTSW 5 100392414 missense probably benign 0.25
R8762:Sec31a UTSW 5 100378829 missense
X0003:Sec31a UTSW 5 100399354 missense probably damaging 0.98
Z1177:Sec31a UTSW 5 100383845 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAACCTGTGCGAACTGTGTTGC -3'
(R):5'- TGCACGTATTACCAGCCTTAC -3'

Sequencing Primer
(F):5'- GCGAACTGTGTTGCAACTTTTCAAC -3'
(R):5'- GCTTATGACCAGGCTATCCC -3'
Posted On2016-06-15