Incidental Mutation 'R5053:Zfp819'
ID 394750
Institutional Source Beutler Lab
Gene Symbol Zfp819
Ensembl Gene ENSMUSG00000055102
Gene Name zinc finger protein 819
Synonyms 4933405K07Rik, 4930427I11Rik
MMRRC Submission 042643-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock # R5053 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 43607169-43618285 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 43617146 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 275 (T275I)
Ref Sequence ENSEMBL: ENSMUSP00000113867 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032661] [ENSMUST00000116324] [ENSMUST00000120935] [ENSMUST00000127765]
AlphaFold Q80V81
Predicted Effect probably damaging
Transcript: ENSMUST00000032661
AA Change: T351I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000032661
Gene: ENSMUSG00000055102
AA Change: T351I

DomainStartEndE-ValueType
KRAB 27 85 1.69e-21 SMART
ZnF_C2H2 300 327 5.4e1 SMART
ZnF_C2H2 356 378 3.74e-5 SMART
ZnF_C2H2 384 406 5.59e-4 SMART
ZnF_C2H2 412 434 1.36e-2 SMART
ZnF_C2H2 440 462 7.78e-3 SMART
ZnF_C2H2 468 490 5.9e-3 SMART
ZnF_C2H2 496 518 1.2e-3 SMART
ZnF_C2H2 524 546 4.79e-3 SMART
ZnF_C2H2 552 574 4.54e-4 SMART
ZnF_C2H2 580 602 3.11e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000116324
AA Change: T351I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000112026
Gene: ENSMUSG00000055102
AA Change: T351I

DomainStartEndE-ValueType
KRAB 27 85 1.69e-21 SMART
ZnF_C2H2 300 327 5.4e1 SMART
ZnF_C2H2 356 378 3.74e-5 SMART
ZnF_C2H2 384 406 5.59e-4 SMART
ZnF_C2H2 412 434 1.36e-2 SMART
ZnF_C2H2 440 462 7.78e-3 SMART
ZnF_C2H2 468 490 5.9e-3 SMART
ZnF_C2H2 496 518 1.2e-3 SMART
ZnF_C2H2 524 546 4.79e-3 SMART
ZnF_C2H2 552 574 4.54e-4 SMART
ZnF_C2H2 580 602 3.11e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120935
AA Change: T275I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113867
Gene: ENSMUSG00000055102
AA Change: T275I

DomainStartEndE-ValueType
ZnF_C2H2 224 251 5.4e1 SMART
ZnF_C2H2 280 302 3.74e-5 SMART
ZnF_C2H2 308 330 5.59e-4 SMART
ZnF_C2H2 336 358 1.36e-2 SMART
ZnF_C2H2 364 386 7.78e-3 SMART
ZnF_C2H2 392 414 5.9e-3 SMART
ZnF_C2H2 420 442 1.2e-3 SMART
ZnF_C2H2 448 470 4.79e-3 SMART
ZnF_C2H2 476 498 4.54e-4 SMART
ZnF_C2H2 504 526 3.11e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127765
SMART Domains Protein: ENSMUSP00000116658
Gene: ENSMUSG00000055102

DomainStartEndE-ValueType
KRAB 27 85 1.69e-21 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.3%
  • 10x: 95.9%
  • 20x: 90.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvrl1 A T 15: 101,137,369 I259F probably damaging Het
Adgrf2 A G 17: 42,710,443 S497P probably damaging Het
Adsl T C 15: 80,960,450 C180R probably damaging Het
Ahctf1 A G 1: 179,786,784 I448T possibly damaging Het
Alg9 G T 9: 50,788,172 G200W probably damaging Het
Amhr2 G A 15: 102,447,258 V213I probably damaging Het
Ankrd44 A T 1: 54,735,089 L200* probably null Het
As3mt A G 19: 46,709,054 Y87C probably damaging Het
Bcl11a C A 11: 24,164,068 F470L probably benign Het
Cacna2d2 A T 9: 107,514,864 Y468F probably damaging Het
Cep250 A G 2: 155,962,928 D71G possibly damaging Het
Clca4b T C 3: 144,911,121 T923A probably benign Het
Clec16a T C 16: 10,576,597 L273P probably damaging Het
Comtd1 T C 14: 21,847,696 D123G probably damaging Het
Cpa5 A T 6: 30,623,272 E144V probably damaging Het
Cyp2c37 G A 19: 40,001,887 S343N probably benign Het
Dennd6a C A 14: 26,608,583 T103K probably damaging Het
Ect2l A G 10: 18,140,345 L733P probably damaging Het
Erg T A 16: 95,524,534 H11L probably benign Het
Ero1lb T C 13: 12,599,906 L253P probably damaging Het
Etfbkmt T A 6: 149,147,268 L135* probably null Het
Frmd4a A T 2: 4,603,921 T867S probably damaging Het
Gm815 C T 19: 26,886,413 A18V unknown Het
Gna12 C A 5: 140,760,727 R321L probably benign Het
Herc1 A T 9: 66,470,326 K3458M possibly damaging Het
Irs1 A G 1: 82,286,922 L1191P probably benign Het
Kcp G T 6: 29,496,958 Q551K probably benign Het
Klhl11 C T 11: 100,472,200 V177M probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Llcfc1 A G 6: 41,685,335 H91R possibly damaging Het
Lmnb2 A T 10: 80,904,655 M223K probably damaging Het
Mbd6 C T 10: 127,286,441 V173I probably benign Het
Mme T A 3: 63,364,849 V623E probably damaging Het
Ndc1 T C 4: 107,374,218 S119P probably damaging Het
Nfs1 A C 2: 156,126,398 C383G probably damaging Het
Nphp4 A G 4: 152,544,462 probably null Het
Oca2 C A 7: 56,323,580 Q411K probably benign Het
Olfr1061 A G 2: 86,413,338 F238S probably damaging Het
Olfr1211 C A 2: 88,930,253 V21F probably benign Het
Olfr1377 G A 11: 50,985,310 G203D probably damaging Het
Olfr479 A G 7: 108,055,534 H184R probably benign Het
Olfr748 T A 14: 50,710,511 Y60* probably null Het
Pcdh7 A T 5: 57,721,601 T493S probably damaging Het
Phf20 T C 2: 156,273,862 S368P probably benign Het
Pla2g2e T G 4: 138,880,375 V22G possibly damaging Het
Plxna1 A T 6: 89,322,460 H1736Q probably damaging Het
Prlr C A 15: 10,325,385 Q215K probably benign Het
Prpf6 T C 2: 181,649,453 V687A probably benign Het
Ptprq T A 10: 107,563,202 T1951S probably damaging Het
Sec31a G T 5: 100,393,214 Q345K possibly damaging Het
Serpina3k T C 12: 104,343,214 probably null Het
Sertad3 T A 7: 27,476,522 V127E probably benign Het
Sf3b1 A T 1: 54,997,177 N912K probably benign Het
Shq1 A G 6: 100,655,259 L202P probably damaging Het
Sp8 C T 12: 118,849,604 T398M probably damaging Het
Tmem150c A T 5: 100,083,740 D125E probably benign Het
Trim3 G T 7: 105,617,761 D470E probably damaging Het
Ubap1 T A 4: 41,387,315 C88* probably null Het
Unc79 T A 12: 103,104,748 D1124E probably damaging Het
Usf3 T C 16: 44,217,187 S677P probably benign Het
Vmn1r76 T C 7: 11,930,314 probably null Het
Zranb2 T A 3: 157,541,159 D161E probably damaging Het
Other mutations in Zfp819
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Zfp819 APN 7 43611979 splice site probably benign
IGL01732:Zfp819 APN 7 43616422 missense probably benign 0.13
IGL02139:Zfp819 APN 7 43612110 critical splice donor site probably null
IGL02276:Zfp819 APN 7 43612004 missense possibly damaging 0.84
R0306:Zfp819 UTSW 7 43617197 missense possibly damaging 0.92
R0620:Zfp819 UTSW 7 43616444 missense probably benign 0.07
R1301:Zfp819 UTSW 7 43617100 missense possibly damaging 0.94
R1314:Zfp819 UTSW 7 43617056 missense probably benign 0.27
R1980:Zfp819 UTSW 7 43616461 missense probably benign
R4545:Zfp819 UTSW 7 43617785 missense probably damaging 0.98
R4993:Zfp819 UTSW 7 43617296 missense probably benign 0.37
R6080:Zfp819 UTSW 7 43616696 missense probably benign 0.00
R7289:Zfp819 UTSW 7 43617082 missense probably damaging 1.00
R7387:Zfp819 UTSW 7 43612641 critical splice donor site probably null
R7608:Zfp819 UTSW 7 43616933 missense probably benign
R7813:Zfp819 UTSW 7 43616767 missense probably benign
R7863:Zfp819 UTSW 7 43617892 missense probably benign 0.17
R8026:Zfp819 UTSW 7 43617895 missense probably benign 0.44
R8080:Zfp819 UTSW 7 43617724 missense probably damaging 1.00
R9072:Zfp819 UTSW 7 43617146 missense probably damaging 1.00
R9073:Zfp819 UTSW 7 43617146 missense probably damaging 1.00
R9199:Zfp819 UTSW 7 43617779 missense probably benign 0.04
Z1176:Zfp819 UTSW 7 43617687 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACCAAATACGAGAAGGTCTTCAC -3'
(R):5'- AGTGTGGATTCTCCGATGCG -3'

Sequencing Primer
(F):5'- GCTTTGTGTCAGCAGCAAAC -3'
(R):5'- ATGCGTGGTGAGGACTGAC -3'
Posted On 2016-06-15