Incidental Mutation 'R5053:Trim3'
ID394753
Institutional Source Beutler Lab
Gene Symbol Trim3
Ensembl Gene ENSMUSG00000036989
Gene Nametripartite motif-containing 3
SynonymsHAC1, Rnf22, BERP1
MMRRC Submission 042643-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5053 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location105604463-105633571 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 105617761 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 470 (D470E)
Ref Sequence ENSEMBL: ENSMUSP00000102403 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057525] [ENSMUST00000106789] [ENSMUST00000106791] [ENSMUST00000147044] [ENSMUST00000153371]
Predicted Effect probably damaging
Transcript: ENSMUST00000057525
AA Change: D470E

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000053384
Gene: ENSMUSG00000036989
AA Change: D470E

DomainStartEndE-ValueType
RING 22 62 6.43e-8 SMART
BBOX 110 151 7.54e-14 SMART
BBC 158 284 2.55e-42 SMART
IG_FLMN 321 421 1.06e-31 SMART
Pfam:NHL 486 513 2.5e-9 PFAM
Pfam:NHL 533 560 1.9e-9 PFAM
Pfam:NHL 575 602 5.5e-8 PFAM
Pfam:NHL 622 649 1e-10 PFAM
Pfam:NHL 669 696 1.8e-12 PFAM
Pfam:NHL 713 740 1.9e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106789
AA Change: D470E

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000102401
Gene: ENSMUSG00000036989
AA Change: D470E

DomainStartEndE-ValueType
RING 22 62 6.43e-8 SMART
BBOX 110 151 7.54e-14 SMART
BBC 158 284 2.55e-42 SMART
IG_FLMN 321 421 1.06e-31 SMART
Pfam:NHL 486 513 1.8e-8 PFAM
Pfam:NHL 533 560 3.9e-10 PFAM
Pfam:NHL 575 602 2.3e-7 PFAM
Pfam:NHL 622 649 3.9e-10 PFAM
Pfam:NHL 669 696 2.2e-12 PFAM
Pfam:NHL 713 740 6.5e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106791
AA Change: D470E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102403
Gene: ENSMUSG00000036989
AA Change: D470E

DomainStartEndE-ValueType
RING 22 62 6.43e-8 SMART
BBOX 110 151 7.54e-14 SMART
BBC 158 284 2.55e-42 SMART
IG_FLMN 321 421 1.06e-31 SMART
Pfam:NHL 486 513 3.4e-8 PFAM
Pfam:NHL 533 560 7.6e-10 PFAM
Pfam:NHL 575 602 4.4e-7 PFAM
Pfam:NHL 622 649 7.6e-10 PFAM
Pfam:NHL 669 696 2.7e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140882
Predicted Effect probably damaging
Transcript: ENSMUST00000147044
AA Change: D470E

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000114822
Gene: ENSMUSG00000036989
AA Change: D470E

DomainStartEndE-ValueType
RING 22 62 6.43e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150363
Predicted Effect probably benign
Transcript: ENSMUST00000153371
SMART Domains Protein: ENSMUSP00000119910
Gene: ENSMUSG00000036989

DomainStartEndE-ValueType
RING 22 62 6.43e-8 SMART
BBOX 110 157 3.55e-10 SMART
Blast:BBC 164 199 9e-15 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154218
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.3%
  • 10x: 95.9%
  • 20x: 90.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family, also called the 'RING-B-box-coiled-coil' (RBCC) subgroup of RING finger proteins. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This protein localizes to cytoplasmic filaments. It is similar to a rat protein which is a specific partner for the tail domain of myosin V, a class of myosins which are involved in the targeted transport of organelles. The rat protein can also interact with alpha-actinin-4. Thus it is suggested that this human protein may play a role in myosin V-mediated cargo transport. Alternatively spliced transcript variants encoding the same isoform have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele have decreased susceptibility to pharmacologically induced seizure as well as reduced miniature inhibitory synaptic current amplitude in cortical neurons. Mice homozygous for another null allele are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvrl1 A T 15: 101,137,369 I259F probably damaging Het
Adgrf2 A G 17: 42,710,443 S497P probably damaging Het
Adsl T C 15: 80,960,450 C180R probably damaging Het
Ahctf1 A G 1: 179,786,784 I448T possibly damaging Het
Alg9 G T 9: 50,788,172 G200W probably damaging Het
Amhr2 G A 15: 102,447,258 V213I probably damaging Het
Ankrd44 A T 1: 54,735,089 L200* probably null Het
As3mt A G 19: 46,709,054 Y87C probably damaging Het
Bcl11a C A 11: 24,164,068 F470L probably benign Het
Cacna2d2 A T 9: 107,514,864 Y468F probably damaging Het
Cep250 A G 2: 155,962,928 D71G possibly damaging Het
Clca4b T C 3: 144,911,121 T923A probably benign Het
Clec16a T C 16: 10,576,597 L273P probably damaging Het
Comtd1 T C 14: 21,847,696 D123G probably damaging Het
Cpa5 A T 6: 30,623,272 E144V probably damaging Het
Cyp2c37 G A 19: 40,001,887 S343N probably benign Het
Dennd6a C A 14: 26,608,583 T103K probably damaging Het
Ect2l A G 10: 18,140,345 L733P probably damaging Het
Erg T A 16: 95,524,534 H11L probably benign Het
Ero1lb T C 13: 12,599,906 L253P probably damaging Het
Etfbkmt T A 6: 149,147,268 L135* probably null Het
Frmd4a A T 2: 4,603,921 T867S probably damaging Het
Gm815 C T 19: 26,886,413 A18V unknown Het
Gna12 C A 5: 140,760,727 R321L probably benign Het
Herc1 A T 9: 66,470,326 K3458M possibly damaging Het
Irs1 A G 1: 82,286,922 L1191P probably benign Het
Kcp G T 6: 29,496,958 Q551K probably benign Het
Klhl11 C T 11: 100,472,200 V177M probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Llcfc1 A G 6: 41,685,335 H91R possibly damaging Het
Lmnb2 A T 10: 80,904,655 M223K probably damaging Het
Mbd6 C T 10: 127,286,441 V173I probably benign Het
Mme T A 3: 63,364,849 V623E probably damaging Het
Ndc1 T C 4: 107,374,218 S119P probably damaging Het
Nfs1 A C 2: 156,126,398 C383G probably damaging Het
Nphp4 A G 4: 152,544,462 probably null Het
Oca2 C A 7: 56,323,580 Q411K probably benign Het
Olfr1061 A G 2: 86,413,338 F238S probably damaging Het
Olfr1211 C A 2: 88,930,253 V21F probably benign Het
Olfr1377 G A 11: 50,985,310 G203D probably damaging Het
Olfr479 A G 7: 108,055,534 H184R probably benign Het
Olfr748 T A 14: 50,710,511 Y60* probably null Het
Pcdh7 A T 5: 57,721,601 T493S probably damaging Het
Phf20 T C 2: 156,273,862 S368P probably benign Het
Pla2g2e T G 4: 138,880,375 V22G possibly damaging Het
Plxna1 A T 6: 89,322,460 H1736Q probably damaging Het
Prlr C A 15: 10,325,385 Q215K probably benign Het
Prpf6 T C 2: 181,649,453 V687A probably benign Het
Ptprq T A 10: 107,563,202 T1951S probably damaging Het
Sec31a G T 5: 100,393,214 Q345K possibly damaging Het
Serpina3k T C 12: 104,343,214 probably null Het
Sertad3 T A 7: 27,476,522 V127E probably benign Het
Sf3b1 A T 1: 54,997,177 N912K probably benign Het
Shq1 A G 6: 100,655,259 L202P probably damaging Het
Sp8 C T 12: 118,849,604 T398M probably damaging Het
Tmem150c A T 5: 100,083,740 D125E probably benign Het
Ubap1 T A 4: 41,387,315 C88* probably null Het
Unc79 T A 12: 103,104,748 D1124E probably damaging Het
Usf3 T C 16: 44,217,187 S677P probably benign Het
Vmn1r76 T C 7: 11,930,314 probably null Het
Zfp819 C T 7: 43,617,146 T275I probably damaging Het
Zranb2 T A 3: 157,541,159 D161E probably damaging Het
Other mutations in Trim3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Trim3 APN 7 105617469 missense probably damaging 1.00
IGL01543:Trim3 APN 7 105613313 missense probably damaging 1.00
IGL01573:Trim3 APN 7 105625493 missense possibly damaging 0.62
IGL01995:Trim3 APN 7 105618482 splice site probably benign
IGL02407:Trim3 APN 7 105613011 missense probably benign 0.44
IGL02868:Trim3 APN 7 105613032 missense possibly damaging 0.82
IGL02837:Trim3 UTSW 7 105612656 missense probably damaging 1.00
PIT4514001:Trim3 UTSW 7 105618210 missense probably benign 0.08
R1013:Trim3 UTSW 7 105617895 missense probably benign 0.10
R2296:Trim3 UTSW 7 105613274 missense probably damaging 1.00
R3724:Trim3 UTSW 7 105611189 missense probably damaging 1.00
R4028:Trim3 UTSW 7 105618245 missense probably benign 0.04
R4347:Trim3 UTSW 7 105619387 missense probably damaging 1.00
R4383:Trim3 UTSW 7 105618399 missense probably damaging 1.00
R4475:Trim3 UTSW 7 105617802 missense probably damaging 1.00
R4567:Trim3 UTSW 7 105613416 missense possibly damaging 0.88
R4886:Trim3 UTSW 7 105617840 missense probably damaging 1.00
R4981:Trim3 UTSW 7 105619128 missense probably damaging 0.99
R5190:Trim3 UTSW 7 105619509 missense probably damaging 1.00
R5230:Trim3 UTSW 7 105619513 missense possibly damaging 0.81
R5364:Trim3 UTSW 7 105619069 missense probably damaging 0.96
R5382:Trim3 UTSW 7 105618347 missense probably benign 0.10
R5712:Trim3 UTSW 7 105619536 missense probably damaging 0.99
R5725:Trim3 UTSW 7 105617740 critical splice donor site probably null
R5915:Trim3 UTSW 7 105617975 missense possibly damaging 0.82
R6058:Trim3 UTSW 7 105611071 missense probably damaging 0.98
R6073:Trim3 UTSW 7 105617539 missense probably damaging 1.00
R6430:Trim3 UTSW 7 105618005 missense probably benign 0.20
R6589:Trim3 UTSW 7 105617960 missense probably damaging 1.00
R7044:Trim3 UTSW 7 105618214 missense probably damaging 0.97
R7207:Trim3 UTSW 7 105613376 missense possibly damaging 0.87
R7326:Trim3 UTSW 7 105617800 nonsense probably null
R7454:Trim3 UTSW 7 105619558 missense probably damaging 1.00
R7459:Trim3 UTSW 7 105617808 missense probably damaging 1.00
R8044:Trim3 UTSW 7 105613258 synonymous silent
R8202:Trim3 UTSW 7 105611425 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- AGATTAGTTTGAGCCTCGCTTC -3'
(R):5'- GTACACTGCACGCACAGAAG -3'

Sequencing Primer
(F):5'- ATTAGTTTGAGCCTCGCTTCCCTAC -3'
(R):5'- CTCAGTGCTGCTCTATGGACAG -3'
Posted On2016-06-15