Incidental Mutation 'R5053:Alg9'
ID 394755
Institutional Source Beutler Lab
Gene Symbol Alg9
Ensembl Gene ENSMUSG00000032059
Gene Name asparagine-linked glycosylation 9 (alpha 1,2 mannosyltransferase)
Synonyms B430313H07Rik, 8230402H15Rik, Dibd1
MMRRC Submission 042643-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R5053 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 50775019-50843542 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 50788172 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Tryptophan at position 200 (G200W)
Ref Sequence ENSEMBL: ENSMUSP00000123711 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034561] [ENSMUST00000159576] [ENSMUST00000162073]
AlphaFold Q8VDI9
Predicted Effect probably damaging
Transcript: ENSMUST00000034561
AA Change: G166W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034561
Gene: ENSMUSG00000032059
AA Change: G166W

DomainStartEndE-ValueType
Pfam:Glyco_transf_22 60 482 3.5e-127 PFAM
low complexity region 598 611 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000159576
AA Change: G200W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123711
Gene: ENSMUSG00000032059
AA Change: G200W

DomainStartEndE-ValueType
Pfam:Glyco_transf_22 60 228 1e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162073
AA Change: W142L

PolyPhen 2 Score 0.124 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000125425
Gene: ENSMUSG00000032059
AA Change: W142L

DomainStartEndE-ValueType
Pfam:Glyco_transf_22 60 167 7.5e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162363
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.3%
  • 10x: 95.9%
  • 20x: 90.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an alpha-1,2-mannosyltransferase enzyme that functions in lipid-linked oligosaccharide assembly. Mutations in this gene result in congenital disorder of glycosylation type Il. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvrl1 A T 15: 101,137,369 I259F probably damaging Het
Adgrf2 A G 17: 42,710,443 S497P probably damaging Het
Adsl T C 15: 80,960,450 C180R probably damaging Het
Ahctf1 A G 1: 179,786,784 I448T possibly damaging Het
Amhr2 G A 15: 102,447,258 V213I probably damaging Het
Ankrd44 A T 1: 54,735,089 L200* probably null Het
As3mt A G 19: 46,709,054 Y87C probably damaging Het
Bcl11a C A 11: 24,164,068 F470L probably benign Het
Cacna2d2 A T 9: 107,514,864 Y468F probably damaging Het
Cep250 A G 2: 155,962,928 D71G possibly damaging Het
Clca4b T C 3: 144,911,121 T923A probably benign Het
Clec16a T C 16: 10,576,597 L273P probably damaging Het
Comtd1 T C 14: 21,847,696 D123G probably damaging Het
Cpa5 A T 6: 30,623,272 E144V probably damaging Het
Cyp2c37 G A 19: 40,001,887 S343N probably benign Het
Dennd6a C A 14: 26,608,583 T103K probably damaging Het
Ect2l A G 10: 18,140,345 L733P probably damaging Het
Erg T A 16: 95,524,534 H11L probably benign Het
Ero1lb T C 13: 12,599,906 L253P probably damaging Het
Etfbkmt T A 6: 149,147,268 L135* probably null Het
Frmd4a A T 2: 4,603,921 T867S probably damaging Het
Gm815 C T 19: 26,886,413 A18V unknown Het
Gna12 C A 5: 140,760,727 R321L probably benign Het
Herc1 A T 9: 66,470,326 K3458M possibly damaging Het
Irs1 A G 1: 82,286,922 L1191P probably benign Het
Kcp G T 6: 29,496,958 Q551K probably benign Het
Klhl11 C T 11: 100,472,200 V177M probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Llcfc1 A G 6: 41,685,335 H91R possibly damaging Het
Lmnb2 A T 10: 80,904,655 M223K probably damaging Het
Mbd6 C T 10: 127,286,441 V173I probably benign Het
Mme T A 3: 63,364,849 V623E probably damaging Het
Ndc1 T C 4: 107,374,218 S119P probably damaging Het
Nfs1 A C 2: 156,126,398 C383G probably damaging Het
Nphp4 A G 4: 152,544,462 probably null Het
Oca2 C A 7: 56,323,580 Q411K probably benign Het
Olfr1061 A G 2: 86,413,338 F238S probably damaging Het
Olfr1211 C A 2: 88,930,253 V21F probably benign Het
Olfr1377 G A 11: 50,985,310 G203D probably damaging Het
Olfr479 A G 7: 108,055,534 H184R probably benign Het
Olfr748 T A 14: 50,710,511 Y60* probably null Het
Pcdh7 A T 5: 57,721,601 T493S probably damaging Het
Phf20 T C 2: 156,273,862 S368P probably benign Het
Pla2g2e T G 4: 138,880,375 V22G possibly damaging Het
Plxna1 A T 6: 89,322,460 H1736Q probably damaging Het
Prlr C A 15: 10,325,385 Q215K probably benign Het
Prpf6 T C 2: 181,649,453 V687A probably benign Het
Ptprq T A 10: 107,563,202 T1951S probably damaging Het
Sec31a G T 5: 100,393,214 Q345K possibly damaging Het
Serpina3k T C 12: 104,343,214 probably null Het
Sertad3 T A 7: 27,476,522 V127E probably benign Het
Sf3b1 A T 1: 54,997,177 N912K probably benign Het
Shq1 A G 6: 100,655,259 L202P probably damaging Het
Sp8 C T 12: 118,849,604 T398M probably damaging Het
Tmem150c A T 5: 100,083,740 D125E probably benign Het
Trim3 G T 7: 105,617,761 D470E probably damaging Het
Ubap1 T A 4: 41,387,315 C88* probably null Het
Unc79 T A 12: 103,104,748 D1124E probably damaging Het
Usf3 T C 16: 44,217,187 S677P probably benign Het
Vmn1r76 T C 7: 11,930,314 probably null Het
Zfp819 C T 7: 43,617,146 T275I probably damaging Het
Zranb2 T A 3: 157,541,159 D161E probably damaging Het
Other mutations in Alg9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01634:Alg9 APN 9 50775377 splice site probably null
IGL02792:Alg9 APN 9 50842748 missense possibly damaging 0.90
gum_drop UTSW 9 50805354 missense possibly damaging 0.90
FR4976:Alg9 UTSW 9 50775431 unclassified probably benign
R1183:Alg9 UTSW 9 50789533 missense possibly damaging 0.82
R1270:Alg9 UTSW 9 50787572 intron probably benign
R1575:Alg9 UTSW 9 50775502 missense possibly damaging 0.65
R1773:Alg9 UTSW 9 50779096 missense probably benign 0.30
R1837:Alg9 UTSW 9 50806315 missense probably damaging 1.00
R2011:Alg9 UTSW 9 50788200 missense probably damaging 1.00
R4324:Alg9 UTSW 9 50805343 missense probably damaging 1.00
R4514:Alg9 UTSW 9 50805354 missense possibly damaging 0.90
R4544:Alg9 UTSW 9 50805354 missense possibly damaging 0.90
R4546:Alg9 UTSW 9 50805354 missense possibly damaging 0.90
R4996:Alg9 UTSW 9 50808705 missense probably damaging 1.00
R5007:Alg9 UTSW 9 50788224 missense probably damaging 1.00
R5308:Alg9 UTSW 9 50822711 missense possibly damaging 0.95
R6803:Alg9 UTSW 9 50789560 missense probably benign 0.37
R6994:Alg9 UTSW 9 50792122 nonsense probably null
R6998:Alg9 UTSW 9 50789621 missense possibly damaging 0.95
R7298:Alg9 UTSW 9 50779061 missense probably damaging 0.97
R7480:Alg9 UTSW 9 50822628 missense probably benign 0.06
R7561:Alg9 UTSW 9 50842774 missense possibly damaging 0.95
R7578:Alg9 UTSW 9 50789535 missense probably benign
R7721:Alg9 UTSW 9 50776642 missense probably damaging 0.99
R7829:Alg9 UTSW 9 50788171 missense probably damaging 1.00
R7847:Alg9 UTSW 9 50789605 missense possibly damaging 0.62
R7878:Alg9 UTSW 9 50842783 missense probably benign 0.00
R8113:Alg9 UTSW 9 50808780 nonsense probably null
R8257:Alg9 UTSW 9 50779087 missense possibly damaging 0.62
R9214:Alg9 UTSW 9 50806245 missense probably damaging 1.00
RF003:Alg9 UTSW 9 50775427 unclassified probably benign
RF006:Alg9 UTSW 9 50775417 unclassified probably benign
RF058:Alg9 UTSW 9 50775427 unclassified probably benign
Z1177:Alg9 UTSW 9 50788173 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCCATTTCCTCTTAAGTAAGGAGC -3'
(R):5'- TGAAGCAGACAGAGACCTGC -3'

Sequencing Primer
(F):5'- CCTCTTAAGTAAGGAGCTTTTTCG -3'
(R):5'- CTGCCCAGGATTCGGGTTATAAAAG -3'
Posted On 2016-06-15