Incidental Mutation 'R5053:Sp8'
ID394767
Institutional Source Beutler Lab
Gene Symbol Sp8
Ensembl Gene ENSMUSG00000048562
Gene Nametrans-acting transcription factor 8
SynonymsmBtd, D930049B17Rik
MMRRC Submission 042643-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.758) question?
Stock #R5053 (G1)
Quality Score123
Status Not validated
Chromosome12
Chromosomal Location118846329-118852576 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 118849604 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 398 (T398M)
Ref Sequence ENSEMBL: ENSMUSP00000065746 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063918] [ENSMUST00000223305]
Predicted Effect probably damaging
Transcript: ENSMUST00000063918
AA Change: T398M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000065746
Gene: ENSMUSG00000048562
AA Change: T398M

DomainStartEndE-ValueType
low complexity region 11 25 N/A INTRINSIC
low complexity region 36 60 N/A INTRINSIC
low complexity region 95 119 N/A INTRINSIC
low complexity region 132 149 N/A INTRINSIC
low complexity region 197 209 N/A INTRINSIC
low complexity region 256 276 N/A INTRINSIC
low complexity region 294 305 N/A INTRINSIC
ZnF_C2H2 356 380 2.63e0 SMART
ZnF_C2H2 386 410 1.84e-4 SMART
ZnF_C2H2 416 438 7.9e-4 SMART
low complexity region 439 454 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000223305
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.3%
  • 10x: 95.9%
  • 20x: 90.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an SP family transcription factor that in mouse has been shown to be essential for proper limb development. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2011]
PHENOTYPE: Homozygous mutant fetuses are characterized by truncated limbs, the lack of a tail, and neural tube defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvrl1 A T 15: 101,137,369 I259F probably damaging Het
Adgrf2 A G 17: 42,710,443 S497P probably damaging Het
Adsl T C 15: 80,960,450 C180R probably damaging Het
Ahctf1 A G 1: 179,786,784 I448T possibly damaging Het
Alg9 G T 9: 50,788,172 G200W probably damaging Het
Amhr2 G A 15: 102,447,258 V213I probably damaging Het
Ankrd44 A T 1: 54,735,089 L200* probably null Het
As3mt A G 19: 46,709,054 Y87C probably damaging Het
Bcl11a C A 11: 24,164,068 F470L probably benign Het
Cacna2d2 A T 9: 107,514,864 Y468F probably damaging Het
Cep250 A G 2: 155,962,928 D71G possibly damaging Het
Clca4b T C 3: 144,911,121 T923A probably benign Het
Clec16a T C 16: 10,576,597 L273P probably damaging Het
Comtd1 T C 14: 21,847,696 D123G probably damaging Het
Cpa5 A T 6: 30,623,272 E144V probably damaging Het
Cyp2c37 G A 19: 40,001,887 S343N probably benign Het
Dennd6a C A 14: 26,608,583 T103K probably damaging Het
Ect2l A G 10: 18,140,345 L733P probably damaging Het
Erg T A 16: 95,524,534 H11L probably benign Het
Ero1lb T C 13: 12,599,906 L253P probably damaging Het
Etfbkmt T A 6: 149,147,268 L135* probably null Het
Frmd4a A T 2: 4,603,921 T867S probably damaging Het
Gm815 C T 19: 26,886,413 A18V unknown Het
Gna12 C A 5: 140,760,727 R321L probably benign Het
Herc1 A T 9: 66,470,326 K3458M possibly damaging Het
Irs1 A G 1: 82,286,922 L1191P probably benign Het
Kcp G T 6: 29,496,958 Q551K probably benign Het
Klhl11 C T 11: 100,472,200 V177M probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Llcfc1 A G 6: 41,685,335 H91R possibly damaging Het
Lmnb2 A T 10: 80,904,655 M223K probably damaging Het
Mbd6 C T 10: 127,286,441 V173I probably benign Het
Mme T A 3: 63,364,849 V623E probably damaging Het
Ndc1 T C 4: 107,374,218 S119P probably damaging Het
Nfs1 A C 2: 156,126,398 C383G probably damaging Het
Nphp4 A G 4: 152,544,462 probably null Het
Oca2 C A 7: 56,323,580 Q411K probably benign Het
Olfr1061 A G 2: 86,413,338 F238S probably damaging Het
Olfr1211 C A 2: 88,930,253 V21F probably benign Het
Olfr1377 G A 11: 50,985,310 G203D probably damaging Het
Olfr479 A G 7: 108,055,534 H184R probably benign Het
Olfr748 T A 14: 50,710,511 Y60* probably null Het
Pcdh7 A T 5: 57,721,601 T493S probably damaging Het
Phf20 T C 2: 156,273,862 S368P probably benign Het
Pla2g2e T G 4: 138,880,375 V22G possibly damaging Het
Plxna1 A T 6: 89,322,460 H1736Q probably damaging Het
Prlr C A 15: 10,325,385 Q215K probably benign Het
Prpf6 T C 2: 181,649,453 V687A probably benign Het
Ptprq T A 10: 107,563,202 T1951S probably damaging Het
Sec31a G T 5: 100,393,214 Q345K possibly damaging Het
Serpina3k T C 12: 104,343,214 probably null Het
Sertad3 T A 7: 27,476,522 V127E probably benign Het
Sf3b1 A T 1: 54,997,177 N912K probably benign Het
Shq1 A G 6: 100,655,259 L202P probably damaging Het
Tmem150c A T 5: 100,083,740 D125E probably benign Het
Trim3 G T 7: 105,617,761 D470E probably damaging Het
Ubap1 T A 4: 41,387,315 C88* probably null Het
Unc79 T A 12: 103,104,748 D1124E probably damaging Het
Usf3 T C 16: 44,217,187 S677P probably benign Het
Vmn1r76 T C 7: 11,930,314 probably null Het
Zfp819 C T 7: 43,617,146 T275I probably damaging Het
Zranb2 T A 3: 157,541,159 D161E probably damaging Het
Other mutations in Sp8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01358:Sp8 APN 12 118848970 missense probably damaging 1.00
IGL01783:Sp8 APN 12 118849024 missense probably benign 0.01
IGL02745:Sp8 APN 12 118849591 missense probably damaging 0.97
R0506:Sp8 UTSW 12 118848565 missense possibly damaging 0.73
R0699:Sp8 UTSW 12 118848820 small deletion probably benign
R1742:Sp8 UTSW 12 118849817 missense probably benign 0.04
R1771:Sp8 UTSW 12 118849567 missense probably damaging 1.00
R1776:Sp8 UTSW 12 118849567 missense probably damaging 1.00
R1791:Sp8 UTSW 12 118849016 missense possibly damaging 0.84
R1926:Sp8 UTSW 12 118849229 missense possibly damaging 0.55
R2159:Sp8 UTSW 12 118848706 missense possibly damaging 0.83
R2223:Sp8 UTSW 12 118849738 missense probably damaging 0.99
R2304:Sp8 UTSW 12 118848569 missense possibly damaging 0.92
R3777:Sp8 UTSW 12 118849015 missense possibly damaging 0.84
R3778:Sp8 UTSW 12 118849015 missense possibly damaging 0.84
R3779:Sp8 UTSW 12 118849015 missense possibly damaging 0.84
R4323:Sp8 UTSW 12 118848436 missense probably benign 0.33
R4360:Sp8 UTSW 12 118848665 missense possibly damaging 0.90
R4428:Sp8 UTSW 12 118849203 missense possibly damaging 0.87
R4883:Sp8 UTSW 12 118849070 missense probably damaging 0.98
R4982:Sp8 UTSW 12 118848425 missense probably damaging 0.99
R5347:Sp8 UTSW 12 118848511 missense possibly damaging 0.91
R5755:Sp8 UTSW 12 118849087 missense probably damaging 0.96
R6219:Sp8 UTSW 12 118848667 missense probably benign 0.27
R7672:Sp8 UTSW 12 118849335 missense possibly damaging 0.47
R7793:Sp8 UTSW 12 118849409 missense probably damaging 0.98
R8548:Sp8 UTSW 12 118849175 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GTTTCAAGCCGGTATTGCC -3'
(R):5'- TCTAGGTACACAAGCCCGAC -3'

Sequencing Primer
(F):5'- TTGCGACTGCCCCAACTG -3'
(R):5'- ATCGCGACAGTCACTCCAGG -3'
Posted On2016-06-15