Incidental Mutation 'R5053:Or11h23'
ID 394771
Institutional Source Beutler Lab
Gene Symbol Or11h23
Ensembl Gene ENSMUSG00000060084
Gene Name olfactory receptor family 11 subfamily G member 23
Synonyms GA_x6K02T2PMLR-6454789-6455712, Olfr748, MOR106-9P
MMRRC Submission 042643-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.066) question?
Stock # R5053 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 50947789-50948712 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 50947968 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 60 (Y60*)
Ref Sequence ENSEMBL: ENSMUSP00000149491 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073561] [ENSMUST00000213101]
AlphaFold E9Q9Z0
Predicted Effect probably null
Transcript: ENSMUST00000073561
AA Change: Y60*
SMART Domains Protein: ENSMUSP00000073251
Gene: ENSMUSG00000060084
AA Change: Y60*

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.6e-52 PFAM
Pfam:7tm_1 41 290 2.8e-24 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000213101
AA Change: Y60*
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.3%
  • 10x: 95.9%
  • 20x: 90.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvrl1 A T 15: 101,035,250 (GRCm39) I259F probably damaging Het
Adgrf2 A G 17: 43,021,334 (GRCm39) S497P probably damaging Het
Adsl T C 15: 80,844,651 (GRCm39) C180R probably damaging Het
Ahctf1 A G 1: 179,614,349 (GRCm39) I448T possibly damaging Het
Alg9 G T 9: 50,699,472 (GRCm39) G200W probably damaging Het
Amhr2 G A 15: 102,355,693 (GRCm39) V213I probably damaging Het
Ankrd44 A T 1: 54,774,248 (GRCm39) L200* probably null Het
As3mt A G 19: 46,697,493 (GRCm39) Y87C probably damaging Het
Bcl11a C A 11: 24,114,068 (GRCm39) F470L probably benign Het
Cacna2d2 A T 9: 107,392,063 (GRCm39) Y468F probably damaging Het
Cep250 A G 2: 155,804,848 (GRCm39) D71G possibly damaging Het
Clca4b T C 3: 144,616,882 (GRCm39) T923A probably benign Het
Clec16a T C 16: 10,394,461 (GRCm39) L273P probably damaging Het
Comtd1 T C 14: 21,897,764 (GRCm39) D123G probably damaging Het
Cpa5 A T 6: 30,623,271 (GRCm39) E144V probably damaging Het
Cyp2c37 G A 19: 39,990,331 (GRCm39) S343N probably benign Het
Dennd6a C A 14: 26,329,738 (GRCm39) T103K probably damaging Het
Ect2l A G 10: 18,016,093 (GRCm39) L733P probably damaging Het
Erg T A 16: 95,325,393 (GRCm39) H11L probably benign Het
Ero1b T C 13: 12,614,795 (GRCm39) L253P probably damaging Het
Etfbkmt T A 6: 149,048,766 (GRCm39) L135* probably null Het
Frmd4a A T 2: 4,608,732 (GRCm39) T867S probably damaging Het
Gm815 C T 19: 26,863,813 (GRCm39) A18V unknown Het
Gna12 C A 5: 140,746,482 (GRCm39) R321L probably benign Het
Herc1 A T 9: 66,377,608 (GRCm39) K3458M possibly damaging Het
Irs1 A G 1: 82,264,643 (GRCm39) L1191P probably benign Het
Kcp G T 6: 29,496,957 (GRCm39) Q551K probably benign Het
Klhl11 C T 11: 100,363,026 (GRCm39) V177M probably damaging Het
Klk14 G A 7: 43,341,501 (GRCm39) C51Y probably damaging Het
Llcfc1 A G 6: 41,662,269 (GRCm39) H91R possibly damaging Het
Lmnb2 A T 10: 80,740,489 (GRCm39) M223K probably damaging Het
Mbd6 C T 10: 127,122,310 (GRCm39) V173I probably benign Het
Mme T A 3: 63,272,270 (GRCm39) V623E probably damaging Het
Ndc1 T C 4: 107,231,415 (GRCm39) S119P probably damaging Het
Nfs1 A C 2: 155,968,318 (GRCm39) C383G probably damaging Het
Nphp4 A G 4: 152,628,919 (GRCm39) probably null Het
Oca2 C A 7: 55,973,328 (GRCm39) Q411K probably benign Het
Or10ab4 A G 7: 107,654,741 (GRCm39) H184R probably benign Het
Or1ad1 G A 11: 50,876,137 (GRCm39) G203D probably damaging Het
Or4c15 C A 2: 88,760,597 (GRCm39) V21F probably benign Het
Or8k25 A G 2: 86,243,682 (GRCm39) F238S probably damaging Het
Pcdh7 A T 5: 57,878,943 (GRCm39) T493S probably damaging Het
Phf20 T C 2: 156,115,782 (GRCm39) S368P probably benign Het
Pla2g2e T G 4: 138,607,686 (GRCm39) V22G possibly damaging Het
Plxna1 A T 6: 89,299,442 (GRCm39) H1736Q probably damaging Het
Prlr C A 15: 10,325,471 (GRCm39) Q215K probably benign Het
Prpf6 T C 2: 181,291,246 (GRCm39) V687A probably benign Het
Ptprq T A 10: 107,399,063 (GRCm39) T1951S probably damaging Het
Sec31a G T 5: 100,541,073 (GRCm39) Q345K possibly damaging Het
Serpina3k T C 12: 104,309,473 (GRCm39) probably null Het
Sertad3 T A 7: 27,175,947 (GRCm39) V127E probably benign Het
Sf3b1 A T 1: 55,036,336 (GRCm39) N912K probably benign Het
Shq1 A G 6: 100,632,220 (GRCm39) L202P probably damaging Het
Sp8 C T 12: 118,813,339 (GRCm39) T398M probably damaging Het
Tmem150c A T 5: 100,231,599 (GRCm39) D125E probably benign Het
Trim3 G T 7: 105,266,968 (GRCm39) D470E probably damaging Het
Ubap1 T A 4: 41,387,315 (GRCm39) C88* probably null Het
Unc79 T A 12: 103,071,007 (GRCm39) D1124E probably damaging Het
Usf3 T C 16: 44,037,550 (GRCm39) S677P probably benign Het
Vmn1r76 T C 7: 11,664,241 (GRCm39) probably null Het
Zfp819 C T 7: 43,266,570 (GRCm39) T275I probably damaging Het
Zranb2 T A 3: 157,246,796 (GRCm39) D161E probably damaging Het
Other mutations in Or11h23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01368:Or11h23 APN 14 50,948,450 (GRCm39) missense possibly damaging 0.95
IGL02965:Or11h23 APN 14 50,948,653 (GRCm39) missense probably damaging 1.00
R0576:Or11h23 UTSW 14 50,948,661 (GRCm39) missense probably damaging 0.98
R1184:Or11h23 UTSW 14 50,948,071 (GRCm39) missense probably benign 0.01
R2129:Or11h23 UTSW 14 50,948,093 (GRCm39) missense probably damaging 0.99
R2895:Or11h23 UTSW 14 50,947,973 (GRCm39) missense probably damaging 0.99
R2896:Or11h23 UTSW 14 50,947,973 (GRCm39) missense probably damaging 0.99
R4017:Or11h23 UTSW 14 50,948,333 (GRCm39) missense probably benign 0.03
R5057:Or11h23 UTSW 14 50,948,669 (GRCm39) missense probably damaging 1.00
R5113:Or11h23 UTSW 14 50,948,371 (GRCm39) missense probably benign 0.00
R5294:Or11h23 UTSW 14 50,948,236 (GRCm39) missense probably benign 0.01
R5294:Or11h23 UTSW 14 50,947,900 (GRCm39) missense possibly damaging 0.95
R5499:Or11h23 UTSW 14 50,948,324 (GRCm39) missense probably damaging 1.00
R5582:Or11h23 UTSW 14 50,948,425 (GRCm39) missense probably damaging 1.00
R5727:Or11h23 UTSW 14 50,947,817 (GRCm39) missense possibly damaging 0.74
R6797:Or11h23 UTSW 14 50,948,563 (GRCm39) missense probably damaging 1.00
R7685:Or11h23 UTSW 14 50,948,215 (GRCm39) missense possibly damaging 0.95
R7717:Or11h23 UTSW 14 50,948,219 (GRCm39) missense probably damaging 1.00
R7778:Or11h23 UTSW 14 50,947,928 (GRCm39) missense possibly damaging 0.60
R8276:Or11h23 UTSW 14 50,948,287 (GRCm39) missense probably benign 0.28
R8839:Or11h23 UTSW 14 50,947,957 (GRCm39) missense possibly damaging 0.73
R9322:Or11h23 UTSW 14 50,948,507 (GRCm39) missense probably damaging 1.00
R9358:Or11h23 UTSW 14 50,947,802 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TGAACGTGTCAGAGGGATCC -3'
(R):5'- TGCCTAGTCATGATGGAAGGATAG -3'

Sequencing Primer
(F):5'- AGAGGGATCCACGGTGACATATTTTG -3'
(R):5'- TGGCTAGGTACCGATCATAAGCC -3'
Posted On 2016-06-15