Incidental Mutation 'R5053:Erg'
ID394779
Institutional Source Beutler Lab
Gene Symbol Erg
Ensembl Gene ENSMUSG00000040732
Gene NameETS transcription factor
SynonymsD030036I24Rik
MMRRC Submission 042643-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5053 (G1)
Quality Score142
Status Not validated
Chromosome16
Chromosomal Location95360204-95530365 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 95524534 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 11 (H11L)
Ref Sequence ENSEMBL: ENSMUSP00000109479 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077773] [ENSMUST00000113846] [ENSMUST00000113848] [ENSMUST00000121809] [ENSMUST00000171646]
Predicted Effect probably benign
Transcript: ENSMUST00000077773
AA Change: H11L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000076949
Gene: ENSMUSG00000040732
AA Change: H11L

DomainStartEndE-ValueType
SAM_PNT 122 206 6.99e-32 SMART
ETS 293 378 9.9e-58 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113846
AA Change: H11L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000109477
Gene: ENSMUSG00000040732
AA Change: H11L

DomainStartEndE-ValueType
SAM_PNT 122 206 6.99e-32 SMART
ETS 317 402 9.9e-58 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113848
AA Change: H11L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000109479
Gene: ENSMUSG00000040732
AA Change: H11L

DomainStartEndE-ValueType
SAM_PNT 122 206 6.99e-32 SMART
ETS 294 379 9.9e-58 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121809
AA Change: H11L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000113723
Gene: ENSMUSG00000040732
AA Change: H11L

DomainStartEndE-ValueType
SAM_PNT 115 199 6.99e-32 SMART
ETS 286 371 9.9e-58 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171646
AA Change: H11L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000132766
Gene: ENSMUSG00000040732
AA Change: H11L

DomainStartEndE-ValueType
SAM_PNT 122 206 6.99e-32 SMART
ETS 270 355 9.9e-58 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.3%
  • 10x: 95.9%
  • 20x: 90.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the erythroblast transformation-specific (ETS) family of transcriptions factors. All members of this family are key regulators of embryonic development, cell proliferation, differentiation, angiogenesis, inflammation, and apoptosis. The protein encoded by this gene is mainly expressed in the nucleus. It contains an ETS DNA-binding domain and a PNT (pointed) domain which is implicated in the self-association of chimeric oncoproteins. This protein is required for platelet adhesion to the subendothelium, inducing vascular cell remodeling. It also regulates hematopoesis, and the differentiation and maturation of megakaryocytic cells. This gene is involved in chromosomal translocations, resulting in different fusion gene products, such as TMPSSR2-ERG and NDRG1-ERG in prostate cancer, EWS-ERG in Ewing's sarcoma and FUS-ERG in acute myeloid leukemia. More than two dozens of transcript variants generated from combinatorial usage of three alternative promoters and multiple alternative splicing events have been reported, but the full-length nature of many of these variants has not been determined. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for an ENU-induced mutation or a knock-out of isoforms 5 - 7 die during organogenesis and exhibit embryonic growth retardation. Mice homozygous for a knock-out of isoforms 1 - 4 are viable and fertile with no overt abnnormalities. Homozygous knock-out mice develop pulmonary venoocclusive disease, with pancytopenia, pulmonary hemorrhage and hypertension, and heart right ventricle hypertrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvrl1 A T 15: 101,137,369 I259F probably damaging Het
Adgrf2 A G 17: 42,710,443 S497P probably damaging Het
Adsl T C 15: 80,960,450 C180R probably damaging Het
Ahctf1 A G 1: 179,786,784 I448T possibly damaging Het
Alg9 G T 9: 50,788,172 G200W probably damaging Het
Amhr2 G A 15: 102,447,258 V213I probably damaging Het
Ankrd44 A T 1: 54,735,089 L200* probably null Het
As3mt A G 19: 46,709,054 Y87C probably damaging Het
Bcl11a C A 11: 24,164,068 F470L probably benign Het
Cacna2d2 A T 9: 107,514,864 Y468F probably damaging Het
Cep250 A G 2: 155,962,928 D71G possibly damaging Het
Clca4b T C 3: 144,911,121 T923A probably benign Het
Clec16a T C 16: 10,576,597 L273P probably damaging Het
Comtd1 T C 14: 21,847,696 D123G probably damaging Het
Cpa5 A T 6: 30,623,272 E144V probably damaging Het
Cyp2c37 G A 19: 40,001,887 S343N probably benign Het
Dennd6a C A 14: 26,608,583 T103K probably damaging Het
Ect2l A G 10: 18,140,345 L733P probably damaging Het
Ero1lb T C 13: 12,599,906 L253P probably damaging Het
Etfbkmt T A 6: 149,147,268 L135* probably null Het
Frmd4a A T 2: 4,603,921 T867S probably damaging Het
Gm815 C T 19: 26,886,413 A18V unknown Het
Gna12 C A 5: 140,760,727 R321L probably benign Het
Herc1 A T 9: 66,470,326 K3458M possibly damaging Het
Irs1 A G 1: 82,286,922 L1191P probably benign Het
Kcp G T 6: 29,496,958 Q551K probably benign Het
Klhl11 C T 11: 100,472,200 V177M probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Llcfc1 A G 6: 41,685,335 H91R possibly damaging Het
Lmnb2 A T 10: 80,904,655 M223K probably damaging Het
Mbd6 C T 10: 127,286,441 V173I probably benign Het
Mme T A 3: 63,364,849 V623E probably damaging Het
Ndc1 T C 4: 107,374,218 S119P probably damaging Het
Nfs1 A C 2: 156,126,398 C383G probably damaging Het
Nphp4 A G 4: 152,544,462 probably null Het
Oca2 C A 7: 56,323,580 Q411K probably benign Het
Olfr1061 A G 2: 86,413,338 F238S probably damaging Het
Olfr1211 C A 2: 88,930,253 V21F probably benign Het
Olfr1377 G A 11: 50,985,310 G203D probably damaging Het
Olfr479 A G 7: 108,055,534 H184R probably benign Het
Olfr748 T A 14: 50,710,511 Y60* probably null Het
Pcdh7 A T 5: 57,721,601 T493S probably damaging Het
Phf20 T C 2: 156,273,862 S368P probably benign Het
Pla2g2e T G 4: 138,880,375 V22G possibly damaging Het
Plxna1 A T 6: 89,322,460 H1736Q probably damaging Het
Prlr C A 15: 10,325,385 Q215K probably benign Het
Prpf6 T C 2: 181,649,453 V687A probably benign Het
Ptprq T A 10: 107,563,202 T1951S probably damaging Het
Sec31a G T 5: 100,393,214 Q345K possibly damaging Het
Serpina3k T C 12: 104,343,214 probably null Het
Sertad3 T A 7: 27,476,522 V127E probably benign Het
Sf3b1 A T 1: 54,997,177 N912K probably benign Het
Shq1 A G 6: 100,655,259 L202P probably damaging Het
Sp8 C T 12: 118,849,604 T398M probably damaging Het
Tmem150c A T 5: 100,083,740 D125E probably benign Het
Trim3 G T 7: 105,617,761 D470E probably damaging Het
Ubap1 T A 4: 41,387,315 C88* probably null Het
Unc79 T A 12: 103,104,748 D1124E probably damaging Het
Usf3 T C 16: 44,217,187 S677P probably benign Het
Vmn1r76 T C 7: 11,930,314 probably null Het
Zfp819 C T 7: 43,617,146 T275I probably damaging Het
Zranb2 T A 3: 157,541,159 D161E probably damaging Het
Other mutations in Erg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00488:Erg APN 16 95369989 splice site probably benign
IGL01096:Erg APN 16 95390053 splice site probably benign
IGL01446:Erg APN 16 95361282 missense probably damaging 1.00
IGL01459:Erg APN 16 95361282 missense probably damaging 1.00
IGL01984:Erg APN 16 95409927 missense probably damaging 1.00
IGL03164:Erg APN 16 95409871 missense possibly damaging 0.94
PIT4515001:Erg UTSW 16 95409760 missense probably benign 0.09
R0499:Erg UTSW 16 95360983 nonsense probably null
R0734:Erg UTSW 16 95370025 missense possibly damaging 0.61
R1880:Erg UTSW 16 95377309 missense probably benign 0.07
R2069:Erg UTSW 16 95361078 missense probably damaging 1.00
R4710:Erg UTSW 16 95390034 missense possibly damaging 0.92
R4749:Erg UTSW 16 95361170 missense probably damaging 1.00
R5284:Erg UTSW 16 95459243 start codon destroyed probably null 0.01
R5694:Erg UTSW 16 95361031 missense probably benign 0.00
R6212:Erg UTSW 16 95379163 missense probably damaging 0.98
R6258:Erg UTSW 16 95380241 missense probably damaging 0.99
R6260:Erg UTSW 16 95380241 missense probably damaging 0.99
R6856:Erg UTSW 16 95368651 critical splice donor site probably null
R7426:Erg UTSW 16 95459156 splice site probably null
R7549:Erg UTSW 16 95369320 critical splice donor site probably null
R7749:Erg UTSW 16 95377357 missense probably benign 0.00
Z1176:Erg UTSW 16 95361317 missense probably damaging 0.99
Z1176:Erg UTSW 16 95409750 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- CTGTGCACACCATTTCACTG -3'
(R):5'- GCAGAGCCAAGCATCTCTAAAG -3'

Sequencing Primer
(F):5'- TTTCACTGAAGGAAGTCCCG -3'
(R):5'- CTCTAAAGACACTATTCTGCGTGG -3'
Posted On2016-06-15