Incidental Mutation 'R5053:Adgrf2'
ID394780
Institutional Source Beutler Lab
Gene Symbol Adgrf2
Ensembl Gene ENSMUSG00000057899
Gene Nameadhesion G protein-coupled receptor F2
SynonymsGpr111, PGR20
MMRRC Submission 042643-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5053 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location42708936-42742179 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 42710443 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 497 (S497P)
Ref Sequence ENSEMBL: ENSMUSP00000109244 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113614]
Predicted Effect probably damaging
Transcript: ENSMUST00000113614
AA Change: S497P

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000109244
Gene: ENSMUSG00000057899
AA Change: S497P

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
GPS 325 376 2.05e-4 SMART
Pfam:7tm_2 378 625 4.1e-29 PFAM
Meta Mutation Damage Score 0.2481 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.3%
  • 10x: 95.9%
  • 20x: 90.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a reporter allele exhibit normal viability and fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvrl1 A T 15: 101,137,369 I259F probably damaging Het
Adsl T C 15: 80,960,450 C180R probably damaging Het
Ahctf1 A G 1: 179,786,784 I448T possibly damaging Het
Alg9 G T 9: 50,788,172 G200W probably damaging Het
Amhr2 G A 15: 102,447,258 V213I probably damaging Het
Ankrd44 A T 1: 54,735,089 L200* probably null Het
As3mt A G 19: 46,709,054 Y87C probably damaging Het
Bcl11a C A 11: 24,164,068 F470L probably benign Het
Cacna2d2 A T 9: 107,514,864 Y468F probably damaging Het
Cep250 A G 2: 155,962,928 D71G possibly damaging Het
Clca4b T C 3: 144,911,121 T923A probably benign Het
Clec16a T C 16: 10,576,597 L273P probably damaging Het
Comtd1 T C 14: 21,847,696 D123G probably damaging Het
Cpa5 A T 6: 30,623,272 E144V probably damaging Het
Cyp2c37 G A 19: 40,001,887 S343N probably benign Het
Dennd6a C A 14: 26,608,583 T103K probably damaging Het
Ect2l A G 10: 18,140,345 L733P probably damaging Het
Erg T A 16: 95,524,534 H11L probably benign Het
Ero1lb T C 13: 12,599,906 L253P probably damaging Het
Etfbkmt T A 6: 149,147,268 L135* probably null Het
Frmd4a A T 2: 4,603,921 T867S probably damaging Het
Gm815 C T 19: 26,886,413 A18V unknown Het
Gna12 C A 5: 140,760,727 R321L probably benign Het
Herc1 A T 9: 66,470,326 K3458M possibly damaging Het
Irs1 A G 1: 82,286,922 L1191P probably benign Het
Kcp G T 6: 29,496,958 Q551K probably benign Het
Klhl11 C T 11: 100,472,200 V177M probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Llcfc1 A G 6: 41,685,335 H91R possibly damaging Het
Lmnb2 A T 10: 80,904,655 M223K probably damaging Het
Mbd6 C T 10: 127,286,441 V173I probably benign Het
Mme T A 3: 63,364,849 V623E probably damaging Het
Ndc1 T C 4: 107,374,218 S119P probably damaging Het
Nfs1 A C 2: 156,126,398 C383G probably damaging Het
Nphp4 A G 4: 152,544,462 probably null Het
Oca2 C A 7: 56,323,580 Q411K probably benign Het
Olfr1061 A G 2: 86,413,338 F238S probably damaging Het
Olfr1211 C A 2: 88,930,253 V21F probably benign Het
Olfr1377 G A 11: 50,985,310 G203D probably damaging Het
Olfr479 A G 7: 108,055,534 H184R probably benign Het
Olfr748 T A 14: 50,710,511 Y60* probably null Het
Pcdh7 A T 5: 57,721,601 T493S probably damaging Het
Phf20 T C 2: 156,273,862 S368P probably benign Het
Pla2g2e T G 4: 138,880,375 V22G possibly damaging Het
Plxna1 A T 6: 89,322,460 H1736Q probably damaging Het
Prlr C A 15: 10,325,385 Q215K probably benign Het
Prpf6 T C 2: 181,649,453 V687A probably benign Het
Ptprq T A 10: 107,563,202 T1951S probably damaging Het
Sec31a G T 5: 100,393,214 Q345K possibly damaging Het
Serpina3k T C 12: 104,343,214 probably null Het
Sertad3 T A 7: 27,476,522 V127E probably benign Het
Sf3b1 A T 1: 54,997,177 N912K probably benign Het
Shq1 A G 6: 100,655,259 L202P probably damaging Het
Sp8 C T 12: 118,849,604 T398M probably damaging Het
Tmem150c A T 5: 100,083,740 D125E probably benign Het
Trim3 G T 7: 105,617,761 D470E probably damaging Het
Ubap1 T A 4: 41,387,315 C88* probably null Het
Unc79 T A 12: 103,104,748 D1124E probably damaging Het
Usf3 T C 16: 44,217,187 S677P probably benign Het
Vmn1r76 T C 7: 11,930,314 probably null Het
Zfp819 C T 7: 43,617,146 T275I probably damaging Het
Zranb2 T A 3: 157,541,159 D161E probably damaging Het
Other mutations in Adgrf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Adgrf2 APN 17 42714315 splice site probably benign
IGL01089:Adgrf2 APN 17 42710158 missense probably damaging 1.00
IGL01601:Adgrf2 APN 17 42710049 missense probably benign
IGL01765:Adgrf2 APN 17 42719535 missense probably benign 0.06
IGL02946:Adgrf2 APN 17 42710493 missense probably damaging 1.00
R0498:Adgrf2 UTSW 17 42714315 splice site probably benign
R0720:Adgrf2 UTSW 17 42713172 missense probably damaging 1.00
R0831:Adgrf2 UTSW 17 42710443 missense probably damaging 0.96
R1664:Adgrf2 UTSW 17 42714414 missense possibly damaging 0.92
R2008:Adgrf2 UTSW 17 42710122 missense probably damaging 0.96
R2306:Adgrf2 UTSW 17 42713119 missense possibly damaging 0.92
R2519:Adgrf2 UTSW 17 42710407 missense probably damaging 1.00
R3713:Adgrf2 UTSW 17 42713088 missense probably damaging 1.00
R3736:Adgrf2 UTSW 17 42711012 missense probably benign 0.32
R4272:Adgrf2 UTSW 17 42710122 missense probably damaging 0.99
R4273:Adgrf2 UTSW 17 42710122 missense probably damaging 0.99
R4422:Adgrf2 UTSW 17 42713155 missense probably benign
R4732:Adgrf2 UTSW 17 42710754 missense probably damaging 1.00
R4733:Adgrf2 UTSW 17 42710754 missense probably damaging 1.00
R4906:Adgrf2 UTSW 17 42711193 missense probably benign
R5078:Adgrf2 UTSW 17 42710986 missense probably damaging 1.00
R5089:Adgrf2 UTSW 17 42710097 missense probably benign 0.00
R5147:Adgrf2 UTSW 17 42710683 missense probably damaging 0.99
R5953:Adgrf2 UTSW 17 42710338 missense probably damaging 1.00
R5968:Adgrf2 UTSW 17 42715172 critical splice donor site probably null
R6791:Adgrf2 UTSW 17 42710883 missense probably benign 0.02
R7138:Adgrf2 UTSW 17 42710983 missense probably damaging 1.00
R7612:Adgrf2 UTSW 17 42714380 missense possibly damaging 0.68
R7670:Adgrf2 UTSW 17 42711372 missense probably damaging 1.00
R8291:Adgrf2 UTSW 17 42710560 missense probably damaging 1.00
R8418:Adgrf2 UTSW 17 42710586 missense probably benign 0.01
R8510:Adgrf2 UTSW 17 42719540 nonsense probably null
X0061:Adgrf2 UTSW 17 42713074 missense probably benign 0.37
X0067:Adgrf2 UTSW 17 42710668 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTACTACAACAATGGCCAGAGC -3'
(R):5'- GTCACCTGTGCATCGCTAAC -3'

Sequencing Primer
(F):5'- CAGAGCTGGTACTACAAAGGCC -3'
(R):5'- TGCATCGCTAACATTGCGG -3'
Posted On2016-06-15